Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-deltaPTB (LMBP 5215)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5215.gb
(View with Genome Compiler) p5215.txt p5215.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human polypyrimidine tract binding protein 1 cDNA (PTBP1, HNRNP-I, HNRPI, pPTB, PTB-1, PTB2, PTB3, PTB4, GeneID 5725); fragment |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS; pCAGGS-E-hPTB |
Further information: | The plasmid was constructed as follows: human ΔPTB was amplified by PCR on pCAGGS-E-hPTB and cloned as an EcoRI/BglII fragment in the EcoRI/BglII opened pCAGGS vector. pCAGGS-deltaPTB is useful for highly efficient expression of human ΔPTB under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. The ΔPTB fragment contains the first two of the four RNA recognition motifs (RRM). When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726973.1. The nucleotide sequence of the human PTBP1 cDNA corresponds with the Genbank Nucleotide Sequence Database accession number NM_002819.4. Name mentioned in Schepens et al. (2005) is pcΔPTB. |
EMBL Accession number: | LT726973.1, view at EMBL, GenBank, DDBJ NM_002819.4, view at GenBank |
Latest sequence update: | 26/01/2007 |
Sequence detail: | Primers used to amplify the hPTBP fragment: forward: 5' CCGGAATTCCACCATGGTCCCCTCTAGAGTGATCCACA 3' Primer O * EcoRI Primer O in Schepens et al. (2005) shows one 'T' more, which is a typing error (B. Schepens, personal communication). reverse: 5' GAAGATCTCTAGAGCTTGGAAAAGTCGATGCGC 3' Primer P * BglII * Schepens et al., Nucl. Acids Res. 33 (2005), 6884-6894 |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglII/EcoRI, EcoRI and NcoI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Schepens et al., Nucleic Acids Res. 33 (2005), 6884-6894 [PMID: 16396835] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-deltaPTB (LMBP 5215) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert and was published in Schepens et al., 2005. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.