GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 19 October 2020 04:30 CEST

Plasmid name: pCAGGSEhA20 (LMBP 3778)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p3778.gb (View with Genome Compiler)
p3778.txt
p3778.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human TNF alpha induced protein 3 cDNA (TNFAIP3, A20, OTUD7C, GeneID 7128)
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pLT10T3A20; pCAGGS; pCAGGS-EmCASP-1
Further information: This plasmid was constructed via a 4-point ligation of the fragments (i) to (iv). Part of the hA20 coding sequence was amplified by PCR, introducing a NotI site at the start codon. The NotI/BamHI fragment from this PCR amplicon (i), containing the N-terminal part of the hA20 gene, was ligated to the BamHI/SalI fragment from pLT10T3A20 (ii), containing the C-terminal part of the hA20 gene, to restore the complete hA20 coding sequence. An E-tag was then ligated to the N-terminus of the hA20 coding sequence as a NotI/PvuI fragment from pCAGGS-EmCASP-1(iii). Finally, the ampicillin resistance gene was restored by ligating the XhoI/PvuI fragment from pCAGGS (iv), resulting in the pCAGGSEhA20 vector.
pCAGGSEhA20 is useful for highly efficient expression of hA20 under the control of the AG promoter and the hCMV-IE enhancer in various mammalian cells.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727385.1.
The nucleotide sequence of the hA20 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number M59465.1.
Other names of the plasmid are pCAGGSEHuA20 and pCAGGS-E-hA20.
EMBL Accession number: M59465.1, view at EMBL, GenBank, DDBJ
LT727385.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 19/06/2000
Sequence detail:
Primers used to introduce a NotI site at the start of hA20:

forward: 5' ATAAGAATGCGGCCGCAATGGCTGAACAAGTCCTTCC 3'
                    NotI
                    
reverse: 5' TGCTCGTCCCCGTCCTGTCC 3'


Nucleotide sequence at the start of the hA20 coding sequence:

           ---------------------- E-tag --------------------->             -- hA20 ->
5' ... ATG.GGT.GCG.CCG.GTG.CCG.TAT.CCG.GAC.CCG.CTG.GAA.CCG.CGT.GCG.GCC.GCA.ATG.GCT ... 3'
       ***                                                     NotI        ***

***: start codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: EcoRI, NotI/SacI and XhoI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: De Valck et al., FEBS Lett. 384 (1996), 61-64 [PMID: 8797804]
De Valck et al., Biochem. Biophys. Res. Commun. 238 (1997), 590-594 [PMID: 9299557]
Zhu et al., Burns 30 (2004), 127-133 [PMID: 15019119]
Coornaert et al., Nat. Immunol. 9 (2008), 263-271 [PMID: 18223652] [DOI: 10.1038/ni1561]
Verstrepen et al., J. Cell. Mol. Med. 12 (2008), 316-329 [PMID: 18081698] [DOI: 10.1111/j.1582-4934.2007.00187.x]
Verhelst et al., EMBO J. 31 (2012), 3845-3855 [PMID: 23032186] [DOI: 10.1038/emboj.2012.240]
Verstrepen et al., J. Cell. Mol. Med. 12 (2008), 316-329 [PMID: 18081698] [DOI: 10.1111/j.1582-4934.2007.00187.x]
Afonina et al., EMBO Rep. 17 (2016), 914-927 [PMID: 27113748] [DOI: 10.15252/embr.201642109]
Maelfait et al., PLoS Pathog. 8 (2012), e1002570 [PMID: 22396652] [DOI: 10.1371/journal.ppat.1002570]
Verhelst er al., Biochem. Biophys. Res. Commun. 465 (2015), 275-280 [PMID: 26260321] [DOI: 10.1016/j.bbrc.2015.08.019]
Ahrens et al., Transplant Direct 1 (2015), e23 [PMID: 27500225] [DOI: 10.1097/TXD.0000000000000533]
PhD thesis Hughes et al. (2003)
Zhou et al., Biomaterials 29 (2008), 2628-2636 [PMID: 18377984] [DOI: 10.1016/j.biomaterials.2008.03.005]
Zhu et al., Burns 30 (2004), 127-133 [PMID: 15019119]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGSEhA20 (LMBP 3778) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search