Last data update: 27 January 2021 04:25 CET
Plasmid name: pCAGGSHIFNB2 (LMBP 2849)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p2849.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human interferon β gene (IFNB, IFNB1) |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS; pSP64GSHIFBSNNT |
Further information: | The plasmid was constructed by inserting the EcoRI-HindIII fragment (sites filled-in with Klenow DNA polymerase) of pSP64GSHIFNBSNNT, containing the human IFNβ gene, into the unique XhoI site (filled in with Klenow DNA polymerase) of pCAGGS. pSP64GSHIFNBSNNT is derived from pSP64GSHIFNBNT (SacI opened, blunted (T4 exonuclease) and ligated with the filled-in (Klenow DNA polymerase) NotI-SFiI linker). pCAGGSHIFNB2 is useful for highly efficient expression of human IFNβ under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. Human IFNβ, used as a stuffer, can be excised as a SfiI fragment in this plasmid. The SfiI sites of the vector are non-compatible (repeated inverse). The human IFNβ gene can be excised from pCAGGSHIFNB1 as SfiI-NotI fragment. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the hIFNβ cDNA corresponds with the EMBL Nucleotide Sequence Database accession number V00546.1. Other name of the plasmid is pCAGGS-Sfi-Sfi-hIFNB. |
EMBL Accession number: | V00546.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 22/05/2000 |
Sequence detail: | Nucleotide sequence at the start of the human IFNß gene: 5'… AAGCTTGGCCAAAAAGGCCTCGAGGAAC ATG ACC AAC … 3' HindIII StuI Met Thr Asn BalI XhoI SfiI Nucleotide sequence at the end of the insert: 5'… TCCCTCGAGGCCTAGCGGCCGCCTAGAGGATCCCCGGGCGCTAGGCGGCCGCTAGGCCTTTTTGGC XhoI NotI BamHI NotI SfiI StuI SmaI CAAGCTCGAATTTCGAGGAATTCAC … 3' EcoRI Nucleotide sequence of the linkers: SfiI-NotI linker : 5' AGCTTGGCCAAAAAGGCCTAGCGGCCGC 3' 3' ACCGGTTTTTCCGGATCGCCGGCGGATC 5' |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by S. Dewaele(1) (2) and Prof. Dr R. Contreras(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGSHIFNB2 (LMBP 2849) is available at BCCM/GeneCorner. This plasmid was deposited by S. Dewaele and Prof. Dr R. Contreras . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.