Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGShCuZnSOD (LMBP 4428)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4428.gb
(View with Genome Compiler) p4428.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human copper/zinc superoxide dismutase cDNA (hCuZnSOD) |
| Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pD5-neoCuZnSOD; pCAGGS |
| Further information: | The plasmid was constructed by inserting human Cu,Zn-superoxide dismutase cDNA (hCuZnSOD) as a BamHI fragment from pD5-neoCuZnSOD into the BalI digested pCAGGS vector (all sites were filled in with Pfu DNA polymerase). pCAGGShCuZnSOD is useful for highly efficient expression of human CuZnSOD under the control of the chicken β-actin/rabbit β-globin hybrid promoter (AG) and the human CMV-IE enhancer in various mammalian cells. The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the hCuZnSOD gene corresponds with the Genbank accession number X02317.1. The border sequences of the human CuZnSOD insert have been sequenced by LMBP. |
| EMBL Accession number: | X02317.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 10/10/2001 |
| Sequence detail: | Nucleotide sequence of the borders of the human CuZnSOD insert
1 5 150 154
5' GGATCCCCGGGGGG.ATG.GCG.ACG.AAG.GCC.GTG.TGC...ATT.GGG.ATC.GCC.CAA.TAA.ACATTCCCTTGGATG
BamHI
TAGTCTGAGGCCCCTTAACTCATCTGTTATCCTGCTAGCTGTAGAAATGTATCCTGATAAACATTAAACACTGTAATCTTAAAAAAA
AAACCCCCCCCCCGGGCGAGCTCGAATTCGGGATCC 3'
EcoRI BamHI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI, NheI and StuI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr V. Goossens(1) (2) and Dr J. Grooten(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGShCuZnSOD (LMBP 4428) is available at BCCM/GeneCorner. This plasmid was deposited by Dr V. Goossens and Dr J. Grooten . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.