GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 25 October 2020 04:11 CET

Plasmid name: pCAT2 (LMBP 5033)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p5033.gb (View with Genome Compiler)
p5033.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Nicotiana plumbaginifolia catalase 2 cDNA (CAT2); fragment (CAT2f)
Promoter: Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli
Parental clone: pBluescriptIIKS+
Further information: The plasmid was constructed by inserting a 1087 bp fragment, containing the 3' region of the Nicotiana plumbaginifolia (tobacco) catalase 2 coding sequence (CAT2), into the EcoRV opened pBluescriptIIKS+ vector.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727073.1.
The nucleotide sequence of the pBluescriptIIKS+ vector corresponds with the Genbank accession number X52327.1. pBluescriptIIKS+ differs from pBluescriptIIKS- in the orientation of the f1 origin.
The nucleotide sequence of the N. plumbaginifolia CAT2 cDNA corresponds with the Genbank accession number Z36976.1.
EMBL Accession number: Z36976.1, view at EMBL, GenBank, DDBJ
X52327.1, view at EMBL, GenBank, DDBJ
LT727073.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 25/05/2005
Sequence detail:
Nucleotide sequence of the inserted N. plumbaginifolia (tobacco) catalase 2 fragment:

          -- T7 promoter ->  
5' ... GCGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATC
                                                     NotI    XbaI  SpeI  BamHI



                                                               <--------------
                           <--------- 3'UTR of CAT2 ----------     492
     CCCCGGGCTGCAGGAATTCGATACCTTATTCAAGTGC ... TTCATCTTAGCTTCA.TCA.CAT.TGT.AGG
      AvaI  PstI  EcoRI                                     +++ Met Thr Pro
      XmaI 


     ------ CAT2f --------------------
                                 196
     CTT.TAA ... TCT.GTA.ATT.TAT.CGG.GATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCG
     Lys Leu     Arg Tyr Asn Ile Pro  HindIII        SalI  XhoI     ApaI  KpnI
                                                        HindII

                        <- T3 promoter --
     GTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCG ... 3'


+++: Termination codon.
: former EcoRV site.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BamHI, EcoRV, HindIII, KpnI, PvuII and XmnI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr D. Inzé(1) (2) and constructed by H. Willekens(1) (2).
(1) Department of Plant Systems Biology, VIB, Ghent, Belgium
(2) Department of Plant Systems Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Willekens et al., FEBS Lett. 352 (1994), 79-83 [PMID: 7925949]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 XL1-Blue
Host reference: Bullock et al., BioTechniques 5 (1987), 376-379
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAT2 (LMBP 5033) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr D. Inzé and constructed by H. Willekens .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search