Last data update: 16 April 2021 10:31 CEST
Plasmid name: pCAT3 (LMBP 5034)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5034.gb
(View with Genome Compiler) p5034.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Nicotiana plumbaginifolia catalase 3 cDNA (CAT3); fragment (CAT3f) |
Promoter: | Phage T7 gene 10 promoter (T7g10) Phage T3 promoter Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
Host range: | Escherichia coli |
Parental clone: | pBluescriptIIKS+ |
Further information: | The plasmid was constructed by inserting a 1059 bp fragment, containing the 3' region of the Nicotiana plumbaginifolia (tobacco) catalase 3 coding sequence (CAT3), into the EcoRV opened pBluescriptIIKS+ vector. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727074.1. The nucleotide sequence of the pBluescriptIIKS+ vector corresponds with the Genbank accession number X52327.1. pBluescriptIIKS+ differs from pBluescriptIIKS- in the orientation of the f1 origin. The nucleotide sequence of the N. plumbaginifolia CAT3 cDNA corresponds with the Genbank accession number Z36977.1.When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. |
EMBL Accession number: | Z36977.1, view at EMBL, GenBank, DDBJ X52327.1, view at EMBL, GenBank, DDBJ LT727074.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 25/05/2005 |
Sequence detail: | Nucleotide sequence of the inserted N. plumbaginifolia (tobacco) catalase 3 fragment: -- T7 promoter -> 5' ... GCGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATC NotI XbaI SpeI BamHI <-------------- <--------- 3'UTR of CAT3 ---------- 492 CCCCGGGCTGCAGGAATTCGATACTTGAACAAAGTAC ... ATACTACTATCAGCT.TCA.CAT.TGT.GGG AvaI PstI EcoRI +++ Met Thr Pro XmaI ------ CAT3f --------------------- 200 CCT.GAC ... ACC.TTC.CAT.GTG.CCT.GTATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCC Arg Val Gly Glu Met His Arg HindIII SalI XhoI ApaI HindII <- T3 promoter -- GGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCG ... 3' KpnI +++: Termination codon. : former EcoRV site. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AvaI, BamHI, HindIII, KpnI, PvuII and XmnI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr D. Inzé(1) (2) and constructed by H. Willekens(1) (2). (1) Department of Plant Systems Biology, VIB, Ghent, Belgium (2) Department of Plant Systems Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Willekens et al., FEBS Lett. 352 (1994), 79-83 [PMID: 7925949] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 XL1-Blue |
Host reference: | Bullock et al., BioTechniques 5 (1987), 376-379 |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAT3 (LMBP 5034) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr D. Inzé and constructed by H. Willekens . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.