GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 21 October 2020 04:26 CEST

Plasmid name: pCAXL (LMBP 5703)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p5703.gb (View with Genome Compiler)
p5703.txt
p5703.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS
Further information: The plasmid was constructed by introducing a multiple cloning site containing the unique sites NheI, SacI, NotI and MluI into the XhoI site of pCAGGS.
This plasmid is useful for highly efficient expression of genes under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.
The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726945.1.
EMBL Accession number: LT726945.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 09/03/2009
Sequence detail:
Nucleotide sequence at the multiple cloning site:

       AG promoter ->
5' ... ATCATTTTGGCAAAGAATTCCTCGAGCTAGCGAGCTCGCGGCCGCACGCGTTCGAGGAATTCACTCC ... 3'
                     EcoRI XhoI NheI  SacI  NotI    MluI       EcoRI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: HincII/SacI, NcoI/PvuI, NotI and SacII.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr M. Schotsaert(1) (2) and Prof. Dr X. Saelens(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAXL (LMBP 5703) is available at BCCM/GeneCorner. This plasmid was deposited by Dr M. Schotsaert and Prof. Dr X. Saelens .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search