GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 22 October 2020 04:25 CEST

Plasmid name: pCD-F-CFP-LVSRG-YFP (LMBP 6115)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p6115.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Aequorea victoria green fluorescent protein DNA (GFP); enhanced cyan fluorescent variant (ECFP)
Aequorea victoria green fluorescent protein DNA (GFP); enhanced yellow-green fluorescent variant (EYFP)
Promoter: Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer
Phage T7 gene 10 promoter (T7g10)
Simian virus 40 early promoter (SV40 early)
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Bovine growth hormone polyadenylation signal (BGH polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Neomycin (neo; G418)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pdECFP; pdEYFP; pCD-F-MK-p20
Further information: The plasmid was constructed by PCR amplifying the CFP and YFP sequences from pdECFP and pdEYFP respectively, and ligating both coding sequences, fused via a MALT1 substrate linker, into the the KpnI/ApaI opened pCD-F-MK-p20 vector, replacing the human MALT1 fragment.
When the construct is expressed, the protein is cleaved by MALT1, resulting in over 33% fluorescense resonance energy transfer from ECFP to EYFP.
The parental clone of this vector has been shown to provide resistance to kanamycin, although growth was reduced compared to growth on medium containing ampicillin.
EMBL Accession number: -
Latest sequence update: 02/04/2009
Sequence detail:
Primers used to amplify CFP cds:

KpnI-XFP-F:  5' ATGGTACCA.ATG.GTG.AGC.AAG.GGC.GAG.G
                          ***

LVSRG-XFP-R: 5' CCCTCTCGAAACTAACTTGTACAGCTCGTCCATGC

Primers used to amplify YFP cds:

ApaI-XFP-R:  5' AAGGGGCCCCTTGTACAGCTCGTCCATGC

LVSRG-XFP-F: 5' TTAGTTTCGAGAGGGATGGTGAGCAAGGGCGAGG

XbaI-LVSRG-F: 5' CAATCTAGATTAGTTTCGAGAGGG

XbaI-LVSRG-R: 5' CAATCTAGACCCTCTCGAAACTAA

***: start codon.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pCD-F-CFP-LVSRG-YFP (LMBP 6115) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search