GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pCD-F-hCYLD-R324A (FMSR/A) (LMBP 6114)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p6114.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human CYLD lysine 63 deubiquitinase cDNA (CYLD, CYLD1, USPL2, GeneID 1540); mutated sequence
FLAG epitope tag; N-terminal
Promoter: Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer
Phage T7 gene 10 promoter (T7g10)
Simian virus 40 early promoter (SV40 early)
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Bovine growth hormone polyadenylation signal (BGH polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Neomycin (neo; G418)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCD-F-MLTp20; pCDNA3-Flag-CYLD
Further information: CYLD is a deubiquitinating enzyme that negatively regulates NF-kappaB activation by TNFR family members.
The hCYLD cds contains a R324A mutation. The plasmid is used to test the MALT1 cleavage site. The arginine in position 324 was the only MALT1 target confirmed in both HEK293T cells and TNT in vitro translation/in vitro cleavage tests.
The parental clone of this vector has been shown to provide resistance to kanamycin, although growth was reduced compared to growth on medium containing ampicillin.
The nucleotide sequence of the wild type human CYLD cDNA corresponds with the EMBL Nucleotide Sequence database accession number AJ250014.1.
Other name of the plasmid is pCD-F-CYLD-R324A (FMSR/A).
EMBL Accession number: AJ250014.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 02/04/2009
Sequence detail:
Primers used to amplify CYLD cds:

Left product:

KpnI-CYLD-F:   5' ATGGTACCA.ATG.AGT.TCA.GGC.TTA.TGG.AGC
                    KpnI    ***

CYLD-FMSR/A-R: 5' CTTTGTCCCCAACACCTGCTGACATAAAGGCAAG

Right product:

ApaI-CYLD-R:   5' TAAGGGCCC.TTA.TTT.GTA.CAA.ACT.CAT.TGT.TGG
                     ApaI   +++

CYLD-FMSR/A-F: 5' CTTGCCTTTATGTCAGCAGGTGTTGGGGACAAAG

***: start codon.
+++: termination codon.
Punctuation indicates reading frame.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Staal et al., EMBO J. 30 (2011), 1742-1752 [PMID: 21448133] [DOI: 10.1038/emboj.2011.85]
Restricted distribution: - BCCM MTA
- Possible extra restrictions defined by the depositor, based on the description of the enduser's research
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCD-F-hCYLD-R324A (FMSR/A) (LMBP 6114) is available at BCCM/GeneCorner. This plasmid was deposited by J. Staal and Prof. Dr R. Beyaert and was published in Staal et al., 2011.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search