Last data update: 24 January 2024 16:39 CET
Plasmid name: pCD-LCK-HLH-F-CePCASP (LMBP 6046)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p6046.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Caenorhabditis elegans paracaspase cDNA (PCASP, MALT1 homolog) Mouse lymphocyte protein tyrosine kinase cDNA (Lck); myristoylation-targeting sequence, N-terminal HLH dimerization domain; N-terminal FLAG epitope tag; N-terminal |
Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCD-F-hSerpinB6; pCD-F-CePCASP |
Further information: | The plasmid was created by inserting the PCR amplified HLH domain and Lck sequence into the HindIII-KpnI openend pCD-F-hSerpinB6 vector, and subsequently replacing the human SerpB6 coding sequence with the type 1 C. elegans PCASP coding sequence obtained from the pCD-F-CePCASP vector as a KpnI/ApaI fragment. Vertebrates typically contain 3 paracaspase paralogs, but all but 1 (PCASP1, MALT1) have been lost in mammals. A direct relative to the ancestral PCASP3 can be found as far back as sea urchins. Among other invertebrates, there are many different lineages of paracaspases. Advanced invertebrates have the "modern" (MALT1-like) DD-Ig1-Ig2-PCASP-Ig3 domain architecture of type 1 paracaspases, whereas primitive invertebrates (sponges, trichoplax,...) have a PCASP-only type protein, classing them as type 2 paracaspases. The parental clone of this vector has been shown to provide resistance to kanamycin, although growth was reduced compared to growth on medium containing ampicillin. The nucleotide sequence of the C. elegans PCASP cDNA corresponds with the Genbank accession number NM_063023.6. Other name of the plasmid is pCD-LCK-HLH-F-CeMALT1. |
EMBL Accession number: | NM_063023.6, view at GenBank |
Latest sequence update: | 09/04/2009 |
Sequence detail: | Primers used to amplify the HLH domain: HindIII-LCK-HLH-F-F: 5' atcagcttaccATGGCGCTGTTGGGGGAC KpnI-LCK-HLH-F-R: 5' ttgtaatccatAACCGGCTGTGTGTGTATAGAGTT Primers used to amplify the LCK tag sequence: HindIII-LCK-F: 5' cataagcttatgggctgtgtctgcagctcaaacc Flag-KpnI-R: 5' taggtaccttatcgtcatcgtccttgta |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Inflammation Research Center, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Hulpiau et al., Cell. Mol. Life Sci. 73 (2016), 1103-1116 [PMID: 26377317] [DOI: 10.1007/s00018-015-2041-9] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCD-LCK-HLH-F-CePCASP (LMBP 6046) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.