Last data update: 18 January 2021 04:24 CET
Plasmid name: pCD-LCK-HLH-F-MLTp10p20 (LMBP 6037)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p6037.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human MALT1 paracaspase cDNA (MALT1, MLT, PCASP1, GeneID 10892); fragment Mouse lymphocyte protein tyrosine kinase cDNA (Lck); myristoylation-targeting sequence, N-terminal HLH dimerization domain; N-terminal FLAG epitope tag; N-terminal |
Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCD-F-MLTp10p20; pCD-F-hSerpinB6 |
Further information: | The plasmid was created by inserting the PCR amplified HLH domain and LCK tag sequence as HindIII/KpnI fragments into pCD-F-hSerpinB6. The human SERPINB6 coding sequence was subsequently cut out with KpnI/ApaI and replaced by the MLTp10p20 sequence from pCD-F-MLTp10p20. The plasmid contains a reverse paracaspase mutant of human MALT1. The parental clone of this vector has been shown to provide resistance to kanamycin, although growth was reduced compared to growth on medium containing ampicillin. The nucleotide sequence of the human MALT1 coding sequence corresponds with the EMBL Nucleotide Sequence Database accession number AF130356.2. |
EMBL Accession number: | AF130356.2, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 09/04/2009 |
Sequence detail: | Primers used to amplify the HLH domain: HindIII-LCK-HLH-F-F: 5' atcagcttaccATGGCGCTGTTGGGGGAC KpnI-LCK-HLH-F-R: 5' ttgtaatccatAACCGGCTGTGTGTGTATAGAGTT Primers used to amplify the LCK tag sequence: HindIII-LCK-F: 5' cataagcttatgggctgtgtctgcagctcaaacc Flag-KpnI-R: 5' taggtaccttatcgtcatcgtccttgta |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCD-LCK-HLH-F-MLTp10p20 (LMBP 6037) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.