Last data update: 24 January 2024 16:39 CET
Plasmid name: pD5-neoCuZnSOD (LMBP 3478)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: | not available |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human copper/zinc superoxide dismutase cDNA (hCuZnSOD) |
| Promoter: | Adenovirus 5 late promoter (Ad5 late) Simian virus 40 promoter (SV40) and enhancer |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418; kanamycin (kan)) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Mammalian cells |
| Parental clone: | pD5-neo; pS61-10 |
| Further information: | The plasmid was constructed as follows: the 600 bp Pst fragment, containing the human Cu,Zn-superoxide dismutase cDNA (hCuZnSOD), was isolated from pS61-10, treated with exonuclease Bal31, provided with BamHI linkers and inserted into the unique BamHI site of pD5-neo. The orientation of the inserted gene should be antisense relative to the Ad5 late promoter. The nucleotide sequence of the hCuZnSOD gene corresponds with the Genbank accession number X02317.1. Other name of the plasmid is pD5-neoCuZnSOD clone 35 anti-sense. |
| EMBL Accession number: | X02317.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 17/05/2001 |
| Sequence detail: | Nucleotide sequence of the borders of the human CuZnSOD insert
1 5 150 154
5' GGATCCCCGGGGGG.ATG.GCG.ACG.AAG.GCC.GTG.TGC...ATT.GGG.ATC.GCC.CAA.TAA.ACATTCCCTTGGATG
BamHI
TAGTCTGAGGCCCCTTAACTCATCTGTTATCCTGCTAGCTGTAGAAATGTATCCTGATAAACATTAAACACTGTAATCTTAAAAAAA
AAACCCCCCCCCCGGGCGAGCTCGAATTCGGGATCC 3'
EcoRI BamHI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI and BglII. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr P. Amstad(1). (1) University of Maryland, USA |
| Plasmid reference: | Amstad et al., Biochemistry 30 (1991), 9305-9313 [PMID: 1654093] |
| Related plasmid reference: | Amstad et al., J. Biol. Chem. 269 (1994), 1606-1609 [PMID: 8294405] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12xB HB101 |
| Host reference: | Boyer and Roulland-Dussoix, J. Mol. Biol. 41 (1969), 459-472 [PMID: 4896022] |
| Related host reference: | Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Sambrook et al. (eds), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY (1989) [ISSN/ISBN: 0879693096] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pD5-neoCuZnSOD (LMBP 3478) is available at BCCM/GeneCorner. This plasmid was deposited by Dr P. Amstad and was published in Amstad et al., 1991. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.