GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 26 November 2020 04:30 CET

Plasmid name: pD5-neoCuZnSOD (LMBP 3478)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: not available
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human copper/zinc superoxide dismutase cDNA (hCuZnSOD)
Promoter: Adenovirus 5 late promoter (Ad5 late)
Simian virus 40 promoter (SV40) and enhancer
Ribosome
binding site:
-
Terminator: -
Selection marker: Ampicillin (amp)
Neomycin (neo; G418; kanamycin (kan))
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Mammalian cells
Parental clone: pD5-neo; pS61-10
Further information: The plasmid was constructed as follows: the 600 bp Pst fragment, containing the human Cu,Zn-superoxide dismutase cDNA (hCuZnSOD), was isolated from pS61-10, treated with exonuclease Bal31, provided with BamHI linkers and inserted into the unique BamHI site of pD5-neo.
The orientation of the inserted gene should be antisense relative to the Ad5 late promoter.
The nucleotide sequence of the hCuZnSOD gene corresponds with the Genbank accession number X02317.1.
Other name of the plasmid is pD5-neoCuZnSOD clone 35 anti-sense.
EMBL Accession number: X02317.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 17/05/2001
Sequence detail:
Nucleotide sequence of the borders of the human CuZnSOD insert 

                   1               5            150             154                         
5' GGATCCCCGGGGGG.ATG.GCG.ACG.AAG.GCC.GTG.TGC...ATT.GGG.ATC.GCC.CAA.TAA.ACATTCCCTTGGATG
   BamHI

TAGTCTGAGGCCCCTTAACTCATCTGTTATCCTGCTAGCTGTAGAAATGTATCCTGATAAACATTAAACACTGTAATCTTAAAAAAA

AAACCCCCCCCCCGGGCGAGCTCGAATTCGGGATCC 3'
                       EcoRI  BamHI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BamHI and BglII.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr P. Amstad(1).
(1) University of Maryland, USA
Plasmid reference: Amstad et al., Biochemistry 30 (1991), 9305-9313 [PMID: 1654093]
Related plasmid reference: Amstad et al., J. Biol. Chem. 269 (1994), 1606-1609 [PMID: 8294405]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12xB HB101
Host reference: Boyer and Roulland-Dussoix, J. Mol. Biol. 41 (1969), 459-472 [PMID: 4896022]
Related host reference: Sambrook et al. (eds), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY (1989) [ISSN/ISBN: 0879693096]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml) + kanamycin (50 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pD5-neoCuZnSOD (LMBP 3478) is available at BCCM/GeneCorner. This plasmid was deposited by Dr P. Amstad and was published in Amstad et al., 1991.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search