GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 30 October 2020 04:11 CET

Plasmid name: pGB-dummy-01-02 (LMBP 11997)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p11997.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: GoldenBac stuffer fragment
Promoter: Phage T7 gene 10 promoter (T7g10)
Phage SP6 promoter
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Insect cells
Parental clone: pGG
Further information: The plasmid was constructed by cloning a stuffer fragment with variable flanking ends into the BsaI-opened pGG vector. This pGG vector is based on pUC19 that was adapted by Lampropoulos et al. for the GreenGate assembly system.
The plasmid is intended to encompass unused positions in co-expression assemblies of the GoldenBac system.
GoldenBac is a modular cloning system designed for insect cells which makes use of a single type IIS restriction endonuclease (BsaI).
Other name of the plasmid is pGB-dummy-01;02.
EMBL Accession number: -
Latest sequence update: 28/11/2019
Sequence detail:
Nucleotide sequence of the BsaI cassette:

GGTCTCAACCTGGCTGAGTAGGCAAGATGTTCTGAACATGAGACC
BsaI   ^^^^<-- dummy sequence --->**** BsaI

^^^^: BsaI overhang 01
****: BsaI overhang 02
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr D. Soroldoni(1). It was constructed by Dr J. Neuhold(1).
(1) Vienna Biocenter Core Facilities GmbH, Vienna, Austria
Plasmid reference: Neuhold et al., BMC Biotechnology 20 (2020), 26 [PMID: 32398045] [DOI: 10.1186/s12896-020-00616-z]
Related plasmid reference: Lampropoulos et al., PLoS ONE 8 (2013), e83043 [PMID: 24376629] [DOI: 10.1371/journal.pone.0083043]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5αT1R
Host reference: -
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pGB-dummy-01-02 (LMBP 11997) is available at BCCM/GeneCorner. This plasmid was deposited by Dr D. Soroldoni and was published in Neuhold et al., 2020.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search