Last data update: 24 January 2024 16:39 CET
Plasmid name: pGB-dummy-03-16 (LMBP 12012)
New search | Print data sheet |
Price category: | Cat. 3 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p12012.gb
(View with Genome Compiler) p12012.txt p12012.pdf |
Sequence analysis results Genecorner: |
Sanger: ef30589197.fasta NGS: a01-gc-may2021.fasta |
Cloned DNA: |
GoldenBac stuffer fragment |
Promoter: | Phage T7 gene 10 promoter (T7g10) Phage SP6 promoter Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Insect cells |
Parental clone: | pGG |
Further information: | The plasmid was constructed by cloning a stuffer fragment with variable flanking ends into the BsaI-opened pGG vector. This pGG vector is based on pUC19 that was adapted by Lampropoulos et al. for the GreenGate assembly system. The plasmid is intended to encompass unused positions in co-expression assemblies of the GoldenBac system. GoldenBac is a modular cloning system designed for insect cells which makes use of a single type IIS restriction endonuclease (BsaI). Other name of the plasmid is pGB-dummy-03;16. |
EMBL Accession number: | - |
Latest sequence update: | 29/11/2019 |
Sequence detail: | Nucleotide sequence of the BsaI cassette: GGTCTCAGGCTGGCTGAGTAGGCAAGATGTTCTGGTATTGAGACC BsaI ^^^^<-- dummy sequence --->**** BsaI ^^^^: BsaI overhang 03 ****: BsaI overhang 16 |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: DraI/PvuII, EcoRI/NdeI and HindIII. The region of the GoldenBac cassette was sequenced at GeneCorner: downstream of the pMB1 ori to the 5' end of the ampicillin resistance gene. This plasmid has also been fully sequenced. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr D. Soroldoni(1). It was constructed by Dr J. Neuhold(1). (1) Vienna Biocenter Core Facilities GmbH, Vienna, Austria |
Plasmid reference: | Neuhold et al., BMC Biotechnol. 20 (2020), 26 [PMID: 32398045] [DOI: 10.1186/s12896-020-00616-z] |
Related plasmid reference: | Lampropoulos et al., PLoS One. 8 (2013), e83043 [PMID: 24376629] [DOI: 10.1371/journal.pone.0083043] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5αT1R |
Host reference: | - |
Related host reference: | Killmann et al., J. Bacteriol. 178 (1996), 6913-6920 [PMID: 8955314] [DOI: 10.1128/jb.178.23.6913-6920.1996] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pGB-dummy-03-16 (LMBP 12012) is available at BCCM/GeneCorner. This plasmid was deposited by Dr D. Soroldoni and was published in Neuhold et al., 2020. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.