GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pGB-dummy-07-16 (LMBP 12016)

Add to cart

New search Print data sheet
Price category: Cat. 2 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p12016.gb (View with Genome Compiler)
p12016.txt
p12016.pdf
Sequence
analysis results
Genecorner:

Sanger: ef30589200.fasta

Cloned DNA: GoldenBac stuffer fragment
Promoter: Phage T7 gene 10 promoter (T7g10)
Phage SP6 promoter
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Insect cells
Parental clone: pGG
Further information: The plasmid was constructed by cloning a stuffer fragment with variable flanking ends into the BsaI-opened pGG vector. This pGG vector is based on pUC19 that was adapted by Lampropoulos et al. for the GreenGate assembly system.
The plasmid is intended to encompass unused positions in co-expression assemblies of the GoldenBac system.
GoldenBac is a modular cloning system designed for insect cells which makes use of a single type IIS restriction endonuclease (BsaI).
Other name of the plasmid is pGB-dummy-07;16.
EMBL Accession number: -
Latest sequence update: 29/11/2019
Sequence detail:
Nucleotide sequence of the BsaI cassette:

GGTCTCACCTGGGCTGAGTAGGCAAGATGTTCTGGTATTGAGACC
BsaI   ^^^^<-- dummy sequence --->**** BsaI

^^^^: BsaI overhang 07
****: BsaI overhang 16
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: DraI/PvuII, EcoRI/NdeI and HindIII.

The region of the GoldenBac cassette was sequenced at GeneCorner: downstream of the pMB1 ori to the 5' end of the ampicillin resistance gene.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr D. Soroldoni(1). It was constructed by Dr J. Neuhold(1).
(1) Vienna Biocenter Core Facilities GmbH, Vienna, Austria
Plasmid reference: Neuhold et al., BMC Biotechnol. 20 (2020), 26 [PMID: 32398045] [DOI: 10.1186/s12896-020-00616-z]
Related plasmid reference: Lampropoulos et al., PLoS One. 8 (2013), e83043 [PMID: 24376629] [DOI: 10.1371/journal.pone.0083043]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5αT1R
Host reference: -
Related host reference: Killmann et al., J. Bacteriol. 178 (1996), 6913-6920 [PMID: 8955314] [DOI: 10.1128/jb.178.23.6913-6920.1996]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pGB-dummy-07-16 (LMBP 12016) is available at BCCM/GeneCorner. This plasmid was deposited by Dr D. Soroldoni and was published in Neuhold et al., 2020.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search