Last data update: 24 January 2024 16:39 CET
Plasmid name: pLT10T3 (LMBP 3384)
| New search | Print data sheet |
| Price category: | Cat. 2 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p3384.gb
(View with Genome Compiler) p3384.txt p3384.pdf |
| Sequence analysis results Genecorner: |
|
| Cloned DNA: |
- |
| Promoter: | Phage λ major leftward promoter (λ PL) Phage T7 gene 10 promoter (T7g10) Phage T3 promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
| Terminator: | Phage fd terminator Phage T7 gene 10 terminator (T7g10) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | pLT10T; pMc58 |
| Further information: | The construction of this plasmid is described in Mertens et al., Gene 164 (1995), 9-15. This is a useful plasmid for heterologous gene expression in E. coli under control of the strong and efficiently regulatable λ PL or T7 gene 10 promoter. Transcriptional read-through from these promoters is minimized by the presence of a duplicated T7 transcription terminator sequence for the T7 RNA polymerase and a duplicated fd transcription terminator sequence for the E. coli RNA polymerase. Opposed to the pET-vectors, read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin. The ribosome binding site from T7 gene 10 is directly accessible after ApaI digestion and blunting the 3' sticky ends, making the ATG start codon on the plasmid accessible for blunt-end ligation of a heterologous coding sequence. Furthermore, pLT10T3 is provided with an extended multiple cloning site downstream from the PL and T7 promoters and with an antisense phage T3 promoter. This plasmid also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7. For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid. The ApaI, EcoRI, SphI, XbaI and XhoI expression sites are not unique (use 3-fragment ligation). The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727476.1. |
| EMBL Accession number: | LT727476.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 22/12/1995 |
| Sequence detail: | Nucleotide sequence around the Shine-Dalgarno (SD) position of the T7 gene 10 ribosome binding site:
-- T7 promoter ->
5' TAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
XbaI
TAAGAAGGAGATATACAT.ATG.GGC.CCG.ACG.TCG.CAT.GCT.CCT.CTA.GAC.TCG
--SD-- *** AatII SphI XbaI XhoI
NdeI ApaI
AGG.AAT.TCG.GTA.CCC.CGG.GTT.CGA.AAT.CGA.TAA.GCT.TAT.GCA.TGC
EcoRI KpnI SmaI AsuII ClaI +++ SphI NotI
HindIII
GGC.CGC.ATC.TAG.AGG.GCC.CGG.ATC.CCT.CGA.GGT.CGA.CGA.ATT.CGA
XbaI ApaI BamHI XhoI SalI EcoRI SacI
<- T3 promoter --
GCT.CGG.CCG.ACT.TGG.CCT.TCC.CTTTAGTGAGGGTTAATA 3'
SfiI
***: start codon.
+++: termination codon.
SD : Shine-Dalgarno sequence.
Punctuation indicates reading frame.
How to make the ATG start codon accessible for blunt-end ligation:
5' ATG.GGC.CCG 3'
3' TAC.CCG.GGC 5'
ApaI
|
| ApaI digestion
|
5' ATG.GGC.C 3'
3' TAC 5'
|
| T4 DNA polymerase
|
5' ATG 3'
3' TAC 5'
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglI, HindIII and HindIII/XmnI. This plasmid has also been fully sequenced. The NGS sequence data still need to be implemented but were unfortunately incomplete. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr N. Mertens(1) (2) and Prof. Dr E. Remaut(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related plasmid reference: | Mertens et al., Biotechnology 13 (1995), 175-179 [PMID: 9634760] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061(λ) |
| Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pLT10T3 (LMBP 3384) is available at BCCM/GeneCorner. This plasmid was deposited by Dr N. Mertens and Prof. Dr E. Remaut and was published in Mertens et al., 1995. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.