GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pPLc2819 (LMBP 482)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: pplc2819.gb (View with Genome Compiler)
pplc2819.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Phage λ major leftward promoter (λ PL)
Ribosome
binding site:
-
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pPLc28
Further information: The plasmid is designed for expression of fragments containing a ribosome binding site functional in E. coli.
There are two HindIII and three Xbal expression sites in the polylinker downstream from the λ PL promoter.
The PstI expression site is not unique: there is another one in the ampicillin resistance gene.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727044.1.
Other name of the plasmid is pST2819 .
EMBL Accession number: LT727044.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 26/01/1989
Sequence detail:
Nucleotide sequence of the polylinker downstream from the PL promoter:


5' GAATTCCGGATCCGGCCAAGCTTGGCTCTAGAGGTCGACCCTCTAGA 
   EcoRI  BamHI     HindIII  XbaI   SalI    XbaI
       BspMII 

   GGCTGCAGCCTCTAGAGCCAAGCTT 3'
     PstI    XbaI     HindIII
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: HaeII, PstI and PvuI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr E. Remaut(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Remaut et al., Gene 15 (1981), 81-93 [PMID: 6271633]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 r-m+ (λ)
Host reference: -
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pPLc2819 (LMBP 482) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut and was published in Remaut et al., 1981.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search