Last data update: 24 January 2024 16:39 CET
Plasmid name: pSP64GMT (LMBP 1762)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | psp64gmt.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | Phage SP6 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | Human interferon α 14 gene terminator (IFNA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pSP64T; pSP64GNNT |
| Further information: | The construction of this vector was done as follows: 1) the HindIII site of pSP64T was opened and filled in with Klenow DNA polymerase; 2) the PstI and BamHI sites of pSP64T were opened and the nucleotides from position 253 to 270 were deleted; 3) the terminator sequence of human interferon α 14 gene, isolated as an AvaI-EcoRI fragment from pSP64GNNT, was inserted into the AvaI-EcoRI opened pSP64T vector; 4) insertion of 'GATCCCAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGG CGAGCTCGAATTCA' into the BglII opened pSP64T. See also pSP64T and pSP64GNNT for basic constructions. It's possible that there is a BalI site before the unique E-HindIII. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. Other name of the plasmid is pSP64TMT. |
| EMBL Accession number: | - |
| Latest sequence update: | 24/05/1989 |
| Sequence detail: | Nucleotide sequence of the multicloning site between the 5' and 3' UTR of the X.laevis ß-globin gene:
*
5' GGCAGATCCCAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGCGAGCTCGAATTC
HindIII PstI SalI XbaI BamHI SacI EcoRI
HindII SmaI HgiJII
AvaI
+
AGATCTGGTTACC 3'
BglII BstEII
*: End of the 5' untranslated region of the X.laevis ß-globin gene.
+: Start of the 3' untranslated region of the X.laevis ß-globin gene. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by L. Stuyver(1) and Prof. Dr R. Contreras(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Krieg et al., Nucleic Acids Res. 12 (1984), 7057-7070 [PMID: 6207484] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSP64GMT (LMBP 1762) is available at BCCM/GeneCorner. This plasmid was deposited by L. Stuyver and Prof. Dr R. Contreras. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.