Last data update: 24 January 2024 16:39 CET
Plasmid name: pSP64GSHIFNBNT (LMBP 2789)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p2789.gb
(View with Genome Compiler) p2789.txt p2789.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human interferon β gene (IFNB, IFNB1) |
| Promoter: | Phage SP6 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Human interferon α 14 gene terminator (IFNA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pSP64GMT; pSPNHIFNB4 |
| Further information: | The plasmid was constructed as follows: a SfiI-NotI linker was inserted between the HindIII and XbaI sites of pSP64GMT. As a result, the XbaI site was lost. After insertion of a XhoI linker between the StuI sites of the new polylinker, the human IFNβ gene was inserted as a XhoI fragment from pSPNHIFNB4. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727546.1. The nucleotide sequence of the hIFNβ cDNA corresponds with the EMBL Nucleotide Sequence Database accession number V00546.1. Other names of the plasmid are pSP64SHIFNBNT and pSP64GHIFNB1. |
| EMBL Accession number: | V00546.1, view at EMBL, GenBank, DDBJ LT727546.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 31/03/1994 |
| Sequence detail: | Nucleotide sequence at the start of the hIFNß gene:
5' ... AAGCTTGGCCAAAAAGGCCTCGAGGAAC.ATG.ACC.AAC ... 3'
HindIII StuI Met Thr Asn
SfiI XhoI ***
Nucleotide sequence at the end of the hIFNß insert:
3'UTR hIFNß -->| |3'UTR ß-globin ->
5' ... TGCAAAAGTC|CCTCGAGGCCTAGCGGCCGCCTAGAGGATCCCCGGGCGAGCTCGAATTCAGATCTG|GTTACCACTA ... 3'
XhoI NotI BamHI SacI EcoRI
StuI
Sequence of the linkers :
SfiI-NotI linker: 5' AGCTTGGCCAAAAAGGCCTAGCGGCCGC 3'
3' ACCGGTTTTTCCGGATCGCCGGCGGATC 5'
XhoI linker : 5' CCTCGAGG 3'
3' GGAGCTCC 5' |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: Alw44I/Eco81I, BglI/Eco130I, HindIII, PstI and XhoI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Tavernier et al., Nucleic Acids Res. 9 (1981), 461-471 [PMID: 6164047] Derynck et al., Nature 287 (1980), 193-197 [PMID: 6159534] Derynck et al., Nature 285 (1980), 542-547 [PMID: 6157094] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSP64GSHIFNBNT (LMBP 2789) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.