GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 11 June 2021 14:12 CEST

Plasmid name: pSP64GSHIFNBNT (LMBP 2789)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p2789.gb (View with Genome Compiler)
p2789.txt
p2789.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human interferon β gene (IFNB, IFNB1)
Promoter: Phage SP6 promoter
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Human interferon α 14 gene terminator (IFNA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Parental clone: pSP64GMT; pSPNHIFNB4
Further information: The plasmid was constructed as follows: a SfiI-NotI linker was inserted between the HindIII and XbaI sites of pSP64GMT. As a result, the XbaI site was lost. After insertion of a XhoI linker between the StuI sites of the new polylinker, the human IFNβ gene was inserted as a XhoI fragment from pSPNHIFNB4.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727546.1.
The nucleotide sequence of the hIFNβ cDNA corresponds with the EMBL Nucleotide Sequence Database accession number V00546.1.
Other names of the plasmid are pSP64SHIFNBNT and pSP64GHIFNB1.
EMBL Accession number: V00546.1, view at EMBL, GenBank, DDBJ
LT727546.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 31/03/1994
Sequence detail:
Nucleotide sequence at the start of the hIFNß gene:

5' ... AAGCTTGGCCAAAAAGGCCTCGAGGAAC.ATG.ACC.AAC ... 3'
       HindIII       StuI           Met Thr Asn
            SfiI         XhoI       ***


Nucleotide sequence at the end of the hIFNß insert:

  3'UTR hIFNß -->|                                                        |3'UTR ß-globin ->
5' ... TGCAAAAGTC|CCTCGAGGCCTAGCGGCCGCCTAGAGGATCCCCGGGCGAGCTCGAATTCAGATCTG|GTTACCACTA ... 3'
                   XhoI       NotI         BamHI       SacI  EcoRI      
                       StuI


Sequence of the linkers :

SfiI-NotI linker:   5' AGCTTGGCCAAAAAGGCCTAGCGGCCGC     3'
                    3'     ACCGGTTTTTCCGGATCGCCGGCGGATC 5'

XhoI linker     :   5' CCTCGAGG 3'
                    3' GGAGCTCC 5'
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: Alw44I/Eco81I, BglI/Eco130I, HindIII, PstI and XhoI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Tavernier et al., Nucleic Acids Res. 9 (1981), 461-471 [PMID: 6164047]
Derynck et al., Nature 287 (1980), 193-197 [PMID: 6159534]
Derynck et al., Nature 285 (1980), 542-547 [PMID: 6157094]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pSP64GSHIFNBNT (LMBP 2789) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search