Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV23SE6L (LMBP 1682)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p1682.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse anti-hPLAP monoclonal antibody E6(IgG2b,κ) cDNA; light chain (E6L) |
| Promoter: | Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pSV23S; pBRE6L |
| Further information: | The cDNA copy of the light chain E6L of the mouse monoclonal antibody E6(IgG2b,κ) from pBRE6L was cloned as a HindIII-SalI fragment in pSV23S. This construction was carried out in two steps: the plasmid pBRE6L was cleaved with BclI, and HindIII linkers ('CCAAGCTTGG') were ligated to the filled-in (with Klenow DNA polymerase) BclI site; after digestion with HindIII and HpaI, the fragment containing the variable domain and part of the constant domain of E6L was purified; in the second step pBRE6L was cleaved with PstI, and SalI linkers ('CGTCGACG') were ligated to the blunted (with T4 DNA polymerase) PstI site; after digestion with HpaI and PstI, the fragment containing the terminal part of the constant domain of E6L was purified; both fragments were then ligated in the HindIII-SalI opened pSV23S vector. The 3' UTR region of E6L still contains 15 dC-nucleotides of the dG/dC tail. pSV23SE6L was designed for transient expression in COS cells or constitutive expression in CHO cells (cotransfection with DHFR plasmids). The E6L cDNA is under control of the SV40 early promoter. Name of he plasmid mentioned in Feys et al. (1988) is pSV23PE6L. |
| EMBL Accession number: | - |
| Latest sequence update: | 21/03/1989 |
| Sequence detail: | Nucleotide sequence in front of the start codon of E6L:
5' AAGCTCAAGCTTGGGATCACACACAGACATGAGT 3'
HindIII ----- *
Filled-in BclI
*: Start codon of E6L. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by P. De Waele(1) and Prof. Dr W. Fiers(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | De Waele et al., Eur. J. Biochem. 176 (1988), 287-295 [PMID: 3138116] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSV23SE6L (LMBP 1682) is available at BCCM/GeneCorner. This plasmid was deposited by P. De Waele and Prof. Dr W. Fiers and was published in De Waele et al., 1988. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.