Last data update: 27 September 2023 10:19 CEST
Plasmid name: pdcDNA-HA (LMBP 4536)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4536.gb
(View with Genome Compiler) p4536.txt p4536.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
B gene of the control of cell death locus of the Escherichia coli F plasmid (ccdB, lethal gene) Influenza HA epitope encoding the haemagglutinin tagging peptide; N-terminal |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter Escherichia coli lac operon promoter; mutant (lacUV5) |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Chloramphenicol (cam) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli; use a ccdB-resistant strain for propagation Mammalian cells; SV40 permissive cells |
| Parental clone: | pcDNA3 |
| Further information: | The plasmid was constructed by converting pcDNA3 to a Gateway destination vector as follows: 1) The Gateway reading frame cassette A (rfA, from Invitrogen) was amplified with primers containing an EcoRV site, the HA epitope and an XhoI site. 2) The PCR product and the vector pcDNA3 (Invitrogen) were digested with EcoRV and XhoI and ligated together, resulting in pdcDNA-HA. pdcDNA-HA is a Gateway destination vector, containing the the ccdB gene flanked by the bacteriophage λ attR recombination sites. pdcDNA-HA is designed for fusing a gene of interest to the N-terminal HA epitope according to the Gateway Cloning Technology (Invitrogen) and for high-level, constitutive, native expression of this gene in mammalian cells under control of the human CMV-IE promoter and enhancer. A Gateway entry clone, containing the gene of interest flanked by the λ attL recombination sites, recombines with the attR sites of the destination vector, replacing the ccdB gene. Standard E. coli strains with the unreacted destination vector or with the by-product plasmid retaining the ccdB gene will fail to grow. Thus, this negative selection provides high-efficiency recovery of only the desired clones. The chloramphenicol resistance gene located between the two attR sites permits counterselection. Unlike pcDNA3, pdcDNA-HA has not been shown to provide resistance to kanamycin. This Gateway destination vector is compatible with the human orfeome library which is also available at BCCM/GeneCorner. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727252.1. The presence of a second enhancer in the SV40 early promoter was shown by sequence analysis at LMBP. The region from the T7 promoter up to nucleotide position 2062 was sequenced by LMBP. Other name of the plasmid is pDEST-HA. |
| EMBL Accession number: | LT727252.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 28/10/2011 |
| Sequence detail: | Primers used to amplify the rfA cassette:
------------ HA epitope ----------> <-- attR1 ---------
forward: 5' GGAGATATC.ATG.TAC.CCA.TAC.GAC.GTC.CCA.GAC.TAC.GCT.ATC.ACA.AGT.TTG.TAC.AAA 3'
EcoRV Met Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ile Thr Ser Leu Tyr Lys
<------ attR2 ---------
reverse: 5' GGGCTCGAGGGGAATCACCACTTTGTACAAGAAAGCTGA 3'
XhoI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI, BglII, EcoRV/XhoI and NcoI. As compared to the nucleotide sequence file, the expected 276 bp BamHI fragment is approximately 425 bp. Furthermore, the 1124 bp NcoI fragment seems to be approximately 1300 bp. However the nucleotide sequence was confirmed by sequencing analysis at GeneCorner. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr F. Van Roy(1) (2). It was constructed by Dr B. Janssens(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Manual of Gateway Cloning Technology (Invitrogen) |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12xB DB3.1 |
| Host reference: | - |
| Related host reference: | Bernard et al., J. Mol. Biol. 226 (1992), 735-745 [PMID: 1324324] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) + chloramphenicol (25 μg/ml)* |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | *: selection of transformants on chloramphenicol; subsequent cultivation of a single colony in liquid medium with ampicillin. |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pdcDNA-HA (LMBP 4536) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr F. Van Roy . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.