Last data update: 24 January 2024 16:39 CET
Plasmid name: YDp-K (LMBP 3354)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
ydp-k.gb
(View with Genome Compiler) ydp-k.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Saccharomyces cerevisiae lysine 2 disruption cassette (LYS2) |
| Promoter: | Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) LYS2; auxotrophic |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Saccharomyces cerevisiae; lys2(-), integrative |
| Parental clone: | pUC9HStop; pRB675 |
| Further information: | The plasmid was constructed by inserting a 5162 bp ClaI (filled in with Klenow DNA polymerase) - EcoRI (filled in with Klenow DNA polymerase) fragment of pRB675 (also named YCp405; Ma et al. (1987)), containing the S. cerevisiae LYS2 auxotrophically selectable marker gene, into the unique HindIII site (filled in with Klenow DNA polymerase) of pUC9HStop, a pUC9 derivative differing in the sequence of the multicloning site. This is an integrative yeast plasmid designed for gene disruption purposes. The disruption cassette consists of the LYS2 gene, flanked by termination codons in all three reading frames and restriction sites. The termination codons prevent read-through from the remaining sequences of disrupted genes and those of the selectable disrupting fragment; in this way, possible artefactual phenotypic effects caused by fortuitous proteins are avoided. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequences at the junctions were experimentally verified by Dr G. Berben prior to deposit at BCCM/GeneCorner. Dr Berben also experimentally confirmed the presence of an unknown 249 bp fragment at the LYS2 3' flanking region. |
| EMBL Accession number: | - |
| Latest sequence update: | 12/10/1995 |
| Sequence detail: | Nucleotide sequence at the termination modules flanking the LYS2 insert:
HindIII/ClaI fusion
stop module |
----------> |--> LYS2 DNA
5' GAATTCCCGGGGATCCGGTGATTGATTGAGCAAGCT|CGATTTGT ...
EcoRI BamHI --- --- ---
SmaI
EcoRI/HindIII fusion
| stop module
--> LYS2 DNA| <----------
... GTGGAATT|AGCTTGCTCAATCAATCACCGGATCCGTCGACCTGCAGCCAAGCTAGCTT 3'
--- --- --- BamHI SalI PstI NheI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/HindIII, ClaI/SspI, EcoRI/PstI, NheI and SmaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr G. Berben(1). (1) Centre de Recherches agronomiques de l' Etat, Station de Chimie et de Physique agricoles, Laboratoire de Microbiologie, Gembloux, Belgium |
| Plasmid reference: | Berben et al., Yeast 7 (1991), 475-477 [PMID: 1897313] |
| Related plasmid reference: | Ma et al., Gene 58 (1987), 201-216 [PMID: 2828185] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1066 |
| Host reference: | Casadaban et al., Methods Enzymol. 100 (1983), 293-298 [PMID: 6312261] |
| Cultivation medium: | LB-Lennox + ampicillin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | Cultivation conditions: preferably under rotational shaking. |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
YDp-K (LMBP 3354) is available at BCCM/GeneCorner. This plasmid was deposited by Dr G. Berben and was published in Berben et al., 1991. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.