Last data update: 24 January 2024 16:39 CET
Plasmid name: p1168hIL6mGATA-luc+ (LMBP 4493)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p4493.gb
(View with Genome Compiler) p4493.txt p4493.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) |
Promoter: | Human interleukin 6 promoter (IL6); mutated sequence |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) Synthetic polyadenylation signal (polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
Host range: | Escherichia coli Mammalian cells |
Parental clone: | pGL3-Basic; pMahIL6P |
Further information: | The plasmid was constructed by inserting the XmaI (SmaI)/HindIII fragment of pMahIL6P, containing the human IL6 promoter, between the XmaI (SmaI) site and HindIII site of pGL3-Basic. The binding site for the GATA transcription factor of the human IL6 promoter was abolished by site-directed mutagenesis, creating an additional XbaI site. Mammalian cells can be directly transfected transiently with the plasmid. However, promoter regulation can be better evaluated when the mammalian cells are stably transfected. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727229.1. The nucleotide sequence of the genomic human IL6 DNA corresponds with the EMBL Nucleotide Sequence Database accession number AC073072.11, except for the C nucleotide at promoter position -174 (polymorphism mutant) which was changed into a G nucleotide (wild type). Other name of the plasmid is p1168huIL6Pluc+SalIGATA(XbaI)mut. |
EMBL Accession number: | AC073072.11, view at EMBL, GenBank, DDBJ LT727229.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 04/05/2004 |
Sequence detail: | Mutator oligonucleotide used: GATA mutant 5' CTCCAACAAAGATTCTAGAAATGTGG 3' XbaI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglI, BglI/SalI, HindIII/XmaI, KpnI, PvuI, PvuI/XbaI, SalI and XbaI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr W. Vanden Berghe(1) and Prof. Dr G. Haegeman(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Vanden Berghe et al., J. Biol. Chem. 273 (1998), 3285-3290 [PMID: 9452444] |
Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 Vanden Berghe et al., J. Biol. Chem. 274 (1999), 32091-32098 [PMID: 10542243] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
p1168hIL6mGATA-luc+ (LMBP 4493) is available at BCCM/GeneCorner. This plasmid was deposited by Dr W. Vanden Berghe and Prof. Dr G. Haegeman and was published in Vanden Berghe et al., 1998. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.