Last data update: 24 January 2024 16:39 CET
Plasmid name: pCMV-mCARMA3-L237LI-myc (LMBP 10228)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | not available |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse caspase recruitment domain family member 10 cDNA (Card10, Bimp1, CARMA3, GeneID 29775); mutated sequence Myc epitope; C-terminal |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pCMV-mCARMA3-myc |
| Further information: | The plasmid was created by introducing an L237LI mutation into the mouse Card10 coding sequence of the pCMV-mCARMA3-myc vector. The L/LI substitution was modelled on the mouse Card11 L232LI mutation. The nucleotide sequence of the mouse Card10 coding sequence corresponds with the Genbank accession number NP_055365.2. |
| EMBL Accession number: | NP_055365.2, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 21/04/2020 |
| Sequence detail: | L/LI substitution modelled on CARMA1 L225LI (L232LI) mutation. Mutation was introduced by amplification of the plasmid using the primers: PHO-mCARMA3-L237LI-F ctcattaagctcaaggtcagccggct PHO-mCARMA3-Q236-R ctggtccaccgccagctgcaggt followed by blunt-end ligation |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCMV-mCARMA3-L237LI-myc (LMBP 10228) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.