Last data update: 24 January 2024 16:39 CET
Plasmid name: pCR3VSV-CED-4 (LMBP 3811)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p3811.gb
(View with Genome Compiler) p3811.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Caenorhabditis elegans cell death protein 4 cDNA (CED-4) Vesicular stomatitis virus glycoprotein (VSV-G) epitope |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Simian virus 40 early promoter (SV40 early) Phage T7 gene 10 promoter (T7g10) Phage SP6 promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Herpes simplex virus (HSV) thymidine kinase polyadenylation signal (TK polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pCR3 |
| Further information: | The plasmid was constructed as follows: the Caenorhabditis elegans cell death protein 4 cDNA (CED-4) was amplified by PCR and inserted in a modified pCR3 vector (Invitrogen). As a result, the CED-4 coding sequence was fused in phase to the N-terminal Vesicular stomatitis virus glycoprotein (VSV-G) epitope. There is uncertainty about the presence of a second enhancer in the SV40 early promoter. The absence of a second enhancer in this promoter may cause bacterial leakage expression of the Tn5 neomycin resistance gene. This would cause transformed E. coli cells to be resistant to kanamycin, although growth should be reduced compared to growth on medium containing ampicillin.names of the plasmid are pCR3-VSVCED-4 and pCRIIIVSVced4. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727395.1. The nucleotide sequence of the CED-4 cDNA corresponds with the Genbank accession number NM_065606.1. |
| EMBL Accession number: | NM_065606.1, view at GenBank LT727395.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 16/02/2005 |
| Sequence detail: | Nucleotide sequence of the fusion gene:
-- T7 promoter -> --------------- VSV
5' ... TAATACGACTCACTATAGGGAGACCCAAGCTTGGTACCGGATCCGCCACC.ATG.TAC.ACC.GAC.ATC.GAG
HindIII BamHI Met Tyr Thr Asp Ile Glu
KpnI ***
epitope --------------> ---------------------- CED-4 ------
ATG.AAC.CGG.TTG.GGC.AAG.GAA.TTG.GGT.CAG.ATG.CTC.TGC.GAA.ATC.GAA ... AAT.TTT
Met Asn Arg Leu Gly Lys Glu Leu Gly Gln Met Leu Cys Glu Ile Glu Asn Phe
***
-------------->
GCA.TGC.TGT.TAA.NNNCTGCAGATATCCATCACACTGGCGGCCGCTCGAGTAGATGACTAGTCTAGAGGGCC
Ala Cys Cys +++ PstI EcoRV NotI AvaI SpeI XbaI ApaI
SphI BstXI XhoI
<- SP6 promoter -
CTATTCTATAGTGTCACCTAAAT ... 3'
***: Start codon.
+++: Termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/NcoI, BssHII, EcoRI, EcoRI/PstI, HindIII/PvuII, SspI and XmnI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr J. Tschopp(1). (1) Department of Biochemistry, University of Lausanne, Switzerland |
| Plasmid reference: | Irmler et al., FEBS Lett. 406 (1997), 189-190 [PMID: 9109415] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCR3VSV-CED-4 (LMBP 3811) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr J. Tschopp and was published in Irmler et al., 1997. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.