GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pEF1-mRIP1-KD-V5-His (LMBP 4827)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p4827.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse receptor TNFRSF-interacting serine-threonine kinase 1 cDNA (Ripk1, Rip1, Rinp, GeneID 19766); kinase domain (Ripk1-KD)
V5 epitope; C-terminal
Histidine tag (His-tag); C-terminal
Promoter: Human elongation factor 1α promoter (EF1α)
Phage T7 gene 10 promoter (T7g10)
Simian virus 40 early promoter (SV40 early)
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Bovine growth hormone polyadenylation signal (BGH polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Neomycin (neo; G418)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pEF1-mRIP-V5/His
Further information: The plasmid was constructed by inserting a 915 bp BamHI-XbaI fragment, containing the kinase domain (KD, encoding amino acids 1-303) of the mouse Ripk1 cDNA, between the BamHI and the XbaI site of pEF1-mRIP-V5/His. As a result, mouse Ripk1-KD was fused in phase to the C-terminal V5 epitope and histidine tag.
pEF1-mRIP1-KD-V5-His is designed for high-level expression of mouse Ripk1-KD under control of the human EF1α promoter in mammalian cells.
There is uncertainty about the presence of a second enhancer in the SV40 early promoter. The absence of a second enhancer in this promoter may cause bacterial leakage expression of the Tn5 neomycin resistance gene.
This would cause transformed E. coli cells to be resistant to kanamycin, although growth should be reduced compared to growth on medium containing ampicillin.
The nucleotide sequence of the mouse Ripk1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number BC058162.1.
Other names of the plasmid are pEF1-mRIP1-KD-His/V5 and pEF1-mRIP-kinase-V5/His.
EMBL Accession number: BC058162.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 08/03/2005
Sequence detail:
Nucleotide sequence of the fusion gene:

       -- T7 promoter ->
5' ... TAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGGTAAGCTTGGTACCGAGCTCGGATCC
                                              HindIII     SacI  BamHI
                                                    KpnI

       ---------------- mRIP1-KD ---------------->
       1                                       303
       ATG.CAA.CCA.GAC.ATG ... GAA.GAG.GAT.GTG.GCA.TCT.AGA.GGG.CCC.TTC
       Met Gln Pro Asp Met     Glu Glu Asp Val Ala Ser Arg Gly Pro Phe
       ***                                         XbaI    ApaI


           --------------------- V5 epitope --------------------->
       GAA.GGT.AAG.CCT.ATC.CCT.AAC.CCT.CTC.CTC.GGT.CTC.GAT.TCT.ACG.CGT
       Glu Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg


               ------- His-tag ------>
       ACC.GGT.CAT.CAT.CAC.CAT.CAC.CAT.TGA.GTTTAAACCCGCTGATC ... 3'
       Thr Gly His His His His His His +++
       AgeI


***: Start codon.
+++: Termination codon.
Punctuation indicates reading frame.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr P. Vandenabeele(1)(2). It was constructed by Dr T. Vanden Berghe(1) (2).
(1) VIB-UGent Center for Inflammation Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pEF1-mRIP1-KD-V5-His (LMBP 4827) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search