Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF6-CYLD-USP-C601A-myc/his (LMBP 8077)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p8077.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human CYLD lysine 63 deubiquitinase cDNA (CYLD, CYLD1, USPL2, GeneID 1540); mutated fragment Myc epitope; C-terminal Histidine tag (His-tag); C-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Synthetic prokaryotic EM7 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Blasticidin (bsd) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli; preferably recombination-deficient and endonuclease A deficient strains Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF6/Myc-HisA; HA-CYLD-C601A |
| Further information: | The plasmid was constructed by PCR amplifying the DUB domain of human CYLD from HA-CYLD-C601A and cloning it as a BamHI/EcoRV fragment into the BamHI/EcoRV opened pEF6/Myc-HisA vector. The plasmid encodes for a catalytically inactive mutant of the DUB domain of human CYLD, containing a C601A mutation. The nucleotide sequence of the wild type human CYLD cDNA corresponds with the EMBL Nucleotide Sequence database accession number AJ250014.1. |
| EMBL Accession number: | AJ250014.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 13/07/2016 |
| Sequence detail: | Primers used to PCR amplify the DUB domain of human CYLD
Forward: 5' AGTAGGATCCTACCATGGGCTTGGAGATAATGATTGGGA
BamHI
Reverse: 5' TAAGGATATCCTTTGTACAAACTCATTGTTGGACTCTG
EcoRV |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Inflammation Research Center, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - VIB/BCCM MTA - Restricted to academic users |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF6-CYLD-USP-C601A-myc/his (LMBP 8077) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.