Last data update: 24 January 2024 16:39 CET
Plasmid name: pEGFP-hnRNPC1 (LMBP 5219)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5219.gb
(View with Genome Compiler) p5219.txt p5219.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Aequorea victoria green fluorescent protein DNA (GFP); enhanced red-shifted variant (EGFP) Human heterogeneous nuclear ribonucleoprotein C cDNA (hnRNPC, HNRNPC); transcript variant 1 (hnRNPC1) |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Escherichia coli β-lactamase promoter (amp) Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli ampicillin resistance gene (amp) |
| Terminator: | Herpes simplex virus (HSV) thymidine kinase polyadenylation signal (TK polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Neomycin (neo; G418; kanamycin (kan)) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pEGFP-C1 |
| Further information: | The plasmid was constructed as follows: 1) The hnRNPC coding sequence was amplified by PCR; 2) The KpnI/BamHI PCR amplicon was cloned in the KpnI/BamHI opened pEGFP-C1 vector. EGFP is a red-shifted variant of wild-type GFP that has been optimized for brighter fluorescence and higher expression in mammalian cells (excitation maximum = 488 nm; emission maximum = 507 nm). EGFP encodes the GFPmut1 variant, which contains the amino acid substitutions Phe-64 to Leu and Ser-65 to Thr. Fusions are expressed under control of the hCMV-IE promoter and enhancer. The neomycin resistance cassette, consisting of the SV40 early promoter, the neomycin/kanamycin resistance gene of Tn5, and HSV-TK polyadenylation signals, allows stably transfected eukaryotic cells to be selected using G418. The E. coli β-lactamase promoter upstream of this cassette expresses kanamycin resistance in E. coli. The neomycin resistance coding sequence does not carry the PstI site anymore, neither the BssHII site. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726977.1. The nucleotide sequence of the hnRNPC cDNA corresponds with the EMBL Nucleotide Sequence Database accession number M29063.1. The nucleotide sequence of the EGFP DNA corresponds with the EMBL Nucleotide Sequence Database accession number U55761.1. |
| EMBL Accession number: | M29063.1, view at EMBL, GenBank, DDBJ U55761.1, view at EMBL, GenBank, DDBJ LT726977.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 06/08/2007 |
| Sequence detail: | Primers used to amplify the hnRNPC coding sequence:
forward: 5' CGGGGTACCATGGCCAGCAACGTTACCAACAAGAC 3'
KpnI
reverse: 5' CGCGGATCCTCCTCCATTGGCGCTGTCTCTGTCAT 3'
BamHI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/KpnI, NcoI and SmaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Schepens et al., EMBO J. 26 (2007), 158-169 [PMID: 17159903] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEGFP-hnRNPC1 (LMBP 5219) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert and was published in Schepens et al., 2007. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.