Last data update: 24 January 2024 16:39 CET
Plasmid name: pEMBLyex-kanMX4 (LMBP 5011)
| New search | Print data sheet |
| Price category: | Cat. 2 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5011.gb
(View with Genome Compiler) p5011.txt p5011.pdf |
| Sequence analysis results Genecorner: |
|
| Cloned DNA: |
- |
| Promoter: | Saccharomyces cerevisiae hybrid UDP-glucose 4-epimerase/iso-1-cytochrome C promoter (GAL10/CYC1) Eremothecium gossypii translation elongation factor 1α promoter (TEF1α) |
| Ribosome binding site: |
- |
| Terminator: | Saccharomyces cerevisiae 2 micron plasmid (2μ) FLP terminator Eremothecium gossypii translation elongation factor 1α terminator (TEF1α) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) Saccharomyces cerevisiae URA3; auxotrophic LEU2 defective (leu2-d; auxotrophic) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Saccharomyces cerevisiae 2 micron plasmid origin (2μ); incl. region conferring stability (STB) |
| Host range: | Escherichia coli Saccharomyces cerevisiae; ura3(-) |
| Parental clone: | pEMBLyex4; pFA6a-kanMX4 |
| Further information: | The plasmid was constructed as follows: the kanMX4 cassette was amplified by PCR on pFA6a-kanMX4 and inserted as a 1395 bp AatII fragment into the AatII opened pEMBLyex4 vector. The kanMX4 cassette contains the Tn903 neomycin coding sequence fused to transcriptional and translational control sequences from the filamentous fungus E. gossypii TEF1α gene, rendering yeast strains resistance to geneticin (G418). The plasmid confers no resistance to kanamycin in bacteria. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727066.1. The nucleotide sequence of the kanMX4 cassette corresponds with the EMBL Nucleotide Sequence Database accession number AJ002680.1. |
| EMBL Accession number: | AJ002680.1, view at EMBL, GenBank, DDBJ LT727066.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 19/05/2005 |
| Sequence detail: | Primers used to amplify the kanMX4 cassette on pFA6a-kanMX4:
forward: 5' ... GACGTCGCCTCGTCCCCGCCGGGTCACCC ... 3'
AatII
reverse: 5' ... GACGTCAGCAGTATAGCGACCAGCATTCAC ... 3'
AatII |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AatII, AgeI, BamHI, EcoRI/PstI, NcoI/XmnI and PvuI. This plasmid has also been fully sequenced. The NGS sequence data still need to be implemented but were unfortunately incomplete. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by S. Dewaele(1) (2) and Prof. Dr R. Contreras(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Wach et al., Yeast 10 (1994), 1793-1808 [PMID: 7747518] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEMBLyex-kanMX4 (LMBP 5011) is available at BCCM/GeneCorner. This plasmid was deposited by S. Dewaele and Prof. Dr R. Contreras . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.