GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pEN208FLP (LMBP 5854)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p5854.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: 2μ FLP recombinase gene
Promoter: Trichoderma reesei cellobiohydrolase I promoter (cbhI)
Ribosome
binding site:
-
Terminator: Trichoderma reesei cellobiohydrolase I terminator (cbhI)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Fungi
Parental clone: pCaFLP-4b; pEN208
Further information: The plasmid was created by treating pEN208 with KpN-T4 and self-ligating the vector, resulting in pEN208deltaKpnI. This vector was restricted with KspI and BclI for the introduction of a linker encoding the 5' part of the FLP gene and a KpnI site, resulting in pEN208+linker. This vector was cut with Bsu36I and KpnI for insertion of a Bsu36I-KpnI fragment from pCaFLP-4b.
EMBL Accession number: -
Latest sequence update: 17/03/2009
Sequence detail:
Linker sequence:

5' GCGGATGCCACAATTTGGTATATTATGTAAAACACCACCTAAGGAGGCAGGTACCTATC 3'
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr N. Callewaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biochemistry and Microbiology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pEN208FLP (LMBP 5854) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr N. Callewaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search