Last data update: 24 January 2024 16:39 CET
Plasmid name: pEN208FLP (LMBP 5854)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p5854.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
2μ FLP recombinase gene |
Promoter: | Trichoderma reesei cellobiohydrolase I promoter (cbhI) |
Ribosome binding site: |
- |
Terminator: | Trichoderma reesei cellobiohydrolase I terminator (cbhI) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Fungi |
Parental clone: | pCaFLP-4b; pEN208 |
Further information: | The plasmid was created by treating pEN208 with KpN-T4 and self-ligating the vector, resulting in pEN208deltaKpnI. This vector was restricted with KspI and BclI for the introduction of a linker encoding the 5' part of the FLP gene and a KpnI site, resulting in pEN208+linker. This vector was cut with Bsu36I and KpnI for insertion of a Bsu36I-KpnI fragment from pCaFLP-4b. |
EMBL Accession number: | - |
Latest sequence update: | 17/03/2009 |
Sequence detail: | Linker sequence: 5' GCGGATGCCACAATTTGGTATATTATGTAAAACACCACCTAAGGAGGCAGGTACCTATC 3' |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr N. Callewaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biochemistry and Microbiology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEN208FLP (LMBP 5854) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr N. Callewaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.