Last data update: 24 January 2024 16:39 CET
Plasmid name: pENScgls2a-MycHDEL (LMBP 5064)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p5064.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Saccharomyces cerevisiae glucosidase ll cDNA (Scgls2); α subunit (Scgls2a, ROT2) Myc epitope; C-terminal HDEL-tag; C-terminal |
| Promoter: | Trichoderma reesei cellobiohydrolase I promoter (cbhI) |
| Ribosome binding site: |
- |
| Terminator: | Trichoderma reesei cellobiohydrolase I terminator (cbhI) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Filamentous fungi; integrative |
| Parental clone: | pEN208; pGAPZScgls2a |
| Further information: | To allow expression in Trichoderma reesei, the yeast ROT2 open reading frame (ORF) was cloned downstream of suitable transcriptional elements such as the strong inducible T. reesei cellobiohydrolase I (cbhI) promoter. Based on the results obtained in Pichia pastoris, the coding sequence of an HDEL-tag was introduced just before the stop codon to allow sufficient ER-localization. A myc-tag, which can be used for checking the levels of protein expression and/or intracellular localization, was inserted just before the HDEL-tag. The myc/HDEL-tagged version of the yeast glucosidase II ORF was generated by PCR using Pfu polymerase and the plasmid pGAPZScgls2a as DNA template. The PCR fragment was KspI/BclI treated and ligated into pEN208, opened by the same restriction enzymes. As such, the yeast ORF was inserted between the cbh1 promoter and termination sequences. Other name of the plasmid is pENglsllScMycHDEL. |
| EMBL Accession number: | - |
| Latest sequence update: | 15/09/2005 |
| Sequence detail: | Primers used to amplify the tagged glucosidase II gene:
Forward: 5' TTTCCGCGGACCATGGTCCTTTTGAAATGGCTC
KspI
Reverse: 5' GCTGATCACTAGAGCTCGTCGTGATTCAGATCCTCTTCTGAGATG
BclI |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr N. Callewaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | PhD thesis Steven Geysens (2004) |
| Related plasmid reference: | Mbongolo Mbella et al., Eur. Food Res. Technol. 232 (2011), 485-496 [DOI: 10.1007/s00217-010-1408-2] Chaouachi et al., Transgenic Res. 22 (2013), 461-476 [PMID: 23400878] [DOI: 10.1007/s11248-012-9684-1] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pENScgls2a-MycHDEL (LMBP 5064) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr N. Callewaert and was published in Steven Geysens, 2004. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.