GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pENTR221-hSTAT1a (LMBP 7963)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p7963.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human signal transducer and activator of transcription 1 cDNA (STAT1, ISGF-3, STAT91, GeneID 6772); isoform alpha
Promoter: Phage T7 gene 10 promoter (T7g10)
Ribosome
binding site:
-
Terminator: Escherichia coli rrnB operon T1 terminator
Escherichia coli rrnB operon T2 terminator
Selection marker: Neomycin (neo; kanamycin (kan))
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Parental clone: pUNO-hSTAT1a
Further information: The plasmid was constructed by PCR amplifying the human STAT1 coding sequence with primers containing the attB1 and attB2 sites, and cloning it into the pDONR221 vector via Gateway recombination.
This is a Gateway Entry vector, allowing for transfer of isoform alpha of the human STAT1 coding sequence to compatible destination vectors via Gateway recombination.
Other name of the plasmid is pDONR221-hSTAT1a.
EMBL Accession number: -
Latest sequence update: 11/06/2015
Sequence detail:
Primers used to amplify the human STAT1 CDS:

                   <---     attB1    --->
attB1-hSTAT1-F: 5' ACAAGTTTGTACAAAAAAGCAG|GCTACC.ATG.TCT.CAG.TGG.TAC.GAA.CTT.CAG 

                   <---     attB2    --->
attB2-hSTAT1-R: 5' ACCACTTTGTACAAGAAAGCTG|GGT.TAC.TGT.GTT.CAT.CAT.ACT.GTC.GAA.T

Punctuation indicates reading frame.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Inflammation Research Center, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + kanamycin (50 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pENTR221-hSTAT1a (LMBP 7963) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search