Last data update: 24 January 2024 16:39 CET
Plasmid name: pENTR3C-NvCARD-CC (LMBP 9873)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p9873.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Nematostella vectensis caspase recruitment domain homolog cDNA (CARD-CC) |
| Promoter: | - |
| Ribosome binding site: |
- |
| Terminator: | Escherichia coli rrnB operon T1 terminator Escherichia coli rrnB operon T2 terminator |
| Selection marker: | Neomycin (neo; kanamycin (kan)) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | - |
| Parental clone: | pENTR3C; pCD-F-NvCARD-CC |
| Further information: | The plasmid was constructed by PCR amplifying the N. vectensis CARD-CC coding sequence from pCD-F-NvCARD-CC and cloning it as a BglII/EcoRV fragment into the into the BamHI/EcoRV opened pENTR3C vector. |
| EMBL Accession number: | - |
| Latest sequence update: | 30/07/2019 |
| Sequence detail: | Primers used to amplify the N. vectensis CARD-CC CDS:
Forward: 5' CCATAGATCTAAGGTACCAATGGAGAACGAGGAAGATTCA
BglII
Reverse: 5' ATCTCAGCTTGTCTTCGCCAGGT |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Staal et al., bioRxiv (2016), 1-42 [DOI: 10.1101/046789] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pENTR3C-NvCARD-CC (LMBP 9873) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert and was published in Staal et al., 2016. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.