Last data update: 24 January 2024 16:39 CET
Plasmid name: pENTR3C-hCARD9-L213LI (LMBP 10173)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | not available |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human caspase recruitment domain family member 9 cDNA (CARD9, GeneID 64170); mutated sequence |
| Promoter: | - |
| Ribosome binding site: |
- |
| Terminator: | Escherichia coli rrnB operon T1 terminator Escherichia coli rrnB operon T2 terminator |
| Selection marker: | Neomycin (neo; kanamycin (kan)) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pENTR3C-hCARD9 |
| Further information: | This Gateway entry plasmid was constructed by introducing an L232LI mutation into the human CARD9 coding sequence of pENTR3C-hCARD9. The L/LI mutation corresponds to the oncogenic L232LI mutation in human CARD11. Human CARD9 is usually poorly active upon overexpression. This construct is made to study activated CARD9. The nucleotide sequence of the wild type human CARD9 coding sequence corresponds with the EMBL Nucleotide Sequence Database accession number AF311287.1. |
| EMBL Accession number: | AF311287.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 28/10/2019 |
| Sequence detail: | Primers used to introduce the L213LI mutation: Forward: 5' CTCATTAAGCACAGCCTCATGAAG Reverse: 5' CTGGTCAATCTCCAGCTGCAGG PCR product was DpnI digested, ligated and transformed into E.coli |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2) and Dr J. Staal(1) (2). (1) Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | De Bruyne et al., Front. Immunol. 9 (2018), 2366 [PMID: 30429846] [DOI: 10.3389/fimmu.2018.02366] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pENTR3C-hCARD9-L213LI (LMBP 10173) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and Dr J. Staal . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.