Last data update: 24 January 2024 16:39 CET
Plasmid name: pET-11b (LMBP 2291)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p2291.gb
(View with Genome Compiler) p2291.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Phage T7 gene 10 (T7g10); first 11 codons Escherichia coli lac repressor gene (lacI) |
Promoter: | Phage T7 gene 10 promoter (T7g10) with lac operator (T7lac) Escherichia coli lac repressor promoter (lacI) |
Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
Terminator: | Phage T7 gene 10 terminator (T7g10) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli |
Parental clone: | pET-10b; pAR4369 |
Further information: | pET-11b is an expression vector useful to maintain and express genes that are toxic to E. coli. The plasmid contains the T7lac promoter, existing of a 25 bp lac operator sequence immediately downstream from the 17 bp T7 promoter. Binding of the lac repressor at this site effectively reduces transcription by T7 RNA polymerase. The plasmid also carries its own copy of the E. coli lac repressor gene (lacI). The first 11 T7g10 codons are also present and the subsequent BamHI expression site generates a GAT codon in the reading frame. Other reading frames are available in pET-11a and pET-11c. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727490.1. |
EMBL Accession number: | LT727490.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 27/04/2004 |
Sequence detail: | The nucleotide sequence following the T7lac promoter: -- T7 promoter -> --- lac operator ---> 5' ... GAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTT XbaI --------------- T7 gene 10 ---------------> 1 5 10 11 AACTTTAAGAAGGAGATATACAT.ATG.GCT.AGC.ATG.ACT.GGT.GGA.CAG.CAA.ATG.GGT.CGG.GAT.CCG ... 3' --SD-- *** NheI BamHI NdeI ***: start codon. SD : Shine-Dalgarno sequence. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI and RsaI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr W. Studier(1). (1) Brookhaven National Laboratory, Upton, New York, USA |
Plasmid reference: | Dubendorff et al., J. Mol. Biol. 219 (1991), 45-59 [PMID: 1902522] |
Related plasmid reference: | Studier et al., Methods Enzymol. 185 (1990), 60-89 [PMID: 2199796] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pET-11b (LMBP 2291) is available at BCCM/GeneCorner. This plasmid was deposited by Dr W. Studier and was published in Dubendorff et al., 1991. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.