Last data update: 24 January 2024 16:39 CET
Plasmid name: pEYFP-p65-mDsRed (LMBP 8324)
| New search | Print data sheet |
| Price category: | Cat. 2 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p8324.gb
(View with Genome Compiler) p8324.txt p8324.pdf |
| Sequence analysis results Genecorner: |
Sanger: 4404874.fasta Sanger: 4404970.fasta |
| Cloned DNA: |
Human nuclear factor κB cDNA (NF-κB); p65 (RELA) subunit Discosoma sp. red fluorescent protein DNA (DsRed1); synthetic monomeric variant (mDsRed), N-terminal |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Escherichia coli β-lactamase promoter (amp) Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli ampicillin resistance gene (amp) |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) Herpes simplex virus (HSV) thymidine kinase polyadenylation signal (TK polyA) |
| Selection marker: | Neomycin (neo; G418; kanamycin (kan)) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pEYFP-p65 |
| Further information: | The plasmid was constructed by replacing the EYFP coding sequence of pEYFP-p65 with the mDsRed coding sequence. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726796.1. The nucleotide sequence of the human NF-κB p65 subunit corresponds with the EMBL Nucleotide Sequence Database accession number M62399.1. The nucleotide sequence of mDsRed corresponds with the EMBL Nucleotide Sequence Database accession number EU827527.1. |
| EMBL Accession number: | M62399.1, view at EMBL, GenBank, DDBJ EU827527.1, view at EMBL, GenBank, DDBJ LT726796.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 13/03/2013 |
| Sequence detail: | The nucleotide sequence of the fusion gene:
hCMV-IE promoter & enhancer -->
5' ... CGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACC
NheI AgeI
HaeII
--------- mDsRed --------->
ATG.GAC.AAC ... GGC.TCC.CAG.TCC.GGA.CTC.AGA.TCT.CGA.GCT.CAA.GCT.TCC.ACC
Met Asp Asn Gly Ser Gln Ser Gly Leu Arg Ser Arg Ala Gln Ala Ser Thr
*** XhoI HindIII
SacI
------- hNF-kB p65 ------->
ATG.GAC.GAA ... ATC.AGC.TCC.TTG.GAT.CCA.CCG.GAT.CTA.GAT.AAC.TGA.TCATAAT ... 3'
Met Asp Glu Ile Ser Ser Leu Asp Pro Pro Asp Leu Asp Asn +++
*** BamHI
***: start codon.
+++: termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/HindIII, EcoRI, HaeII and PstI. The region downstream from the human CMV-IE promoter and enhancer and upstream from the SV40 polyA was sequenced at GeneCorner. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr J.A. Schmid(1). (1) Center for Physiology and Pharmacology, Medical University Vienna, Vienna, Austria |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEYFP-p65-mDsRed (LMBP 8324) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr J.A. Schmid. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.