Last data update: 24 January 2024 16:39 CET
Plasmid name: pGEM-mCLDex4-probeR2 (LMBP 7884)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | not available |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse CYLD lysine 63 deubiquitinase gDNA (Cyld, CYLD1); fragment (probe R2) |
| Promoter: | Escherichia coli lac operon promoter Phage T7 gene 10 promoter (T7g10) Phage SP6 promoter |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pGEM-T Easy |
| Further information: | The plasmid was constructed by PCR amplifying the region close to mouse CYLD exon 4 and cloning it into the pGEM-T Easy vector. This plasmid contains a southern blot probe corresponding to nucleotides 16081901-16082306 on mouse chromosome 8. The sequence was amplified from mouse C57BL/6J genomic DNA. The purpose of the probe is to detect correct insertion events in mouse CYLD exon 4 (for example: pEASY-FLIRT-mCYLD-R321A-KI). |
| EMBL Accession number: | - |
| Latest sequence update: | 11/06/2015 |
| Sequence detail: | Primers used to amplify nucleotides 16081901-16082306 of C57BL/6J mouse chromosome 8: CYLD-probeR2-F: 5' GGCAGGAAGTAGGTGGTGAAT CYLD-probeR2-R: 5' TGACTTCCAGAGTCAGCATCA |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Inflammation Research Center, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pGEM-mCLDex4-probeR2 (LMBP 7884) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.