Last data update: 24 January 2024 16:39 CET
Plasmid name: pGEX-mRIP1-D138N (LMBP 4933)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p4933.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse receptor TNFRSF-interacting serine-threonine kinase 1 cDNA (Ripk1, Rip1, Rinp, GeneID 19766); mutated sequence Thrombin recognition site; N-terminal Schistosoma japonicum Sj26 antigen glutathione S-transferase gene (GST); N-terminal Escherichia coli lac repressor gene (lacI) |
| Promoter: | Escherichia coli hybrid tryptophan/lacUV5 promoter (tac) Escherichia coli lac repressor promoter; mutant (lacI(q)) Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pGEX-4T2; pEF1-mRIP1-D138N-V5/His |
| Further information: | The plasmid was constructed by PCR amplifying the mutated mouse Ripk1 coding sequence from pEF1-mRIP-D138N-V5/His, and cloning it as a BamHI-XhoI fragment into the pGEX-4T2 vector. The aspartic acid (D) codon at amino acid position 138 of mouse Ripk1 was replaced by an asparagine (N) codon, resulting in the loss of an AvaII site. Transcription of the fusion gene GST-mRIP1m is controlled by the binding of the lac repressor, encoded by the lacI gene, to the lac operator of the E. coli tac promoter. pGEX-mRIP1-D138N can be used for the synthesis of the GST-mRIP1m fusion protein in E. coli. The GST carrier can be cleaved from the fusion protein by digestion with the site-specific protease thrombin. The nucleotide sequence of the pGEX-4T2 vector corresponds with the EMBL Nucleotide Sequence Database accession number U13854.1. The nucleotide sequence of the wild type mouse Ripk1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number BC058162.1. |
| EMBL Accession number: | U13854.1, view at EMBL, GenBank, DDBJ BC058162.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 23/02/2005 |
| Sequence detail: | Primers used to amplify mRIP1m:
Forward primer: 5' CGGATCC.ATG.CAA.CCA.GAC.ATG.TCC.TTG 3'
BamHI ***
Reverse primer: 5' C.CGC.TCG.AGC.GCT.CTG.GCT.GGC.ACG.AAT.CAA.GTG 3'
XhoI
Nucleotide sequence of the fusion gene:
---------- tac promoter ---------->------------- lacZ RBS ------------>
5' ... GTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGTA
HindII
----------------------- GST ----------------------> -- thrombin
TTC.ATG.TCC.CCT.ATA.CTA.GGT ... GGC.GAC.CAT.CCT.CCA.AAA.TCG.GAT.CTG.GTT.CCG
Met Ser Pro Ile Leu Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro
***
recogn. --> ---------------------------------- mRIP1m ---------------------
1 138
CGT.GGA.TCC.ATG.CAA.CCA.GAC.ATG.TCC ... CAC.AAG.AAC.CTG.AAG ... ATT.CGT.GCC
Arg Gly Ser Met Gln Pro Asp Met Ser His Lys Asn Leu Lys Ile Arg Ala
BamHI *** StyI ^
---------->
656
AGC.CAG.AGC.GCT.CGA.GCG.GCC.GCA.TCG.TGA.CTGACTGACGATCTG ... 3'
Ser Gln Ser Ala Arg Ala Ala Ala Ser +++
XhoI NotI
***: Start codon.
^ : Mutated nucleotide.
+++: Termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by Dr N. Festjens(1) (2). (1) VIB-UGent Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pGEX-mRIP1-D138N (LMBP 4933) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.