Last data update: 24 January 2024 16:39 CET
Plasmid name: pGL3hEcadP (LMBP 4804)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4804.gb
(View with Genome Compiler) p4804.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) |
| Promoter: | Human E-cadherin promoter (hE-cad) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) Synthetic polyadenylation signal (polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli Mammalian cells |
| Parental clone: | pGL3-Basic |
| Further information: | The plasmid was constructed by inserting the E-cadherin promoter sequence (-221/+19), obtained by PCR on genomic DNA from the human MCF7/AZ cell line, between the KpnI and HindIII sites of pGL3-Basic. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727040.1. The nucleotide sequence of the hE-cad promoter corresponds with the EMBL Nucleotide Sequence Database accession number L34545.1 except for an extra C nucleotide at position -39; and nucleotide position -161 is A instead of C. The region between the f1 ori and the LUC cds was sequenced by LMBP. Other name of the plasmid is pGL3basic-hEcadpromWT. |
| EMBL Accession number: | L34545.1, view at EMBL, GenBank, DDBJ LT727040.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 07/06/2004 |
| Sequence detail: | forward primer:5' GGGGTACCATCAGAACCGTGCAGGTCCCA 3'
KpnI
reverse primer: 5' CCCAAGCTTGCAGTTCCGACGCCACTGAGA 3'
HindIII |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglI, BstEII, HindIII and NaeI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr G. Berx (1) (2) and constructed by Dr J. Comijn(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Comijn et al., Mol. Cell 7 (2001), 1267-1278 [PMID: 11430829] |
| Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pGL3hEcadP (LMBP 4804) is available at BCCM/GeneCorner. This plasmid was deposited by Dr G. Berx and constructed by Dr J. Comijn and was published in Comijn et al., 2001. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.