Last data update: 24 January 2024 16:39 CET
Plasmid name: pGal4-p65S276C (LMBP 4644)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4644.gb
(View with Genome Compiler) p4644.txt p4644.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Saccharomyces cerevisiae GAL4 DNA-binding domain (GALbd) Human nuclear factor κB cDNA (NF-κB); mutated p65 (RELA) subunit |
| Promoter: | Rous sarcoma virus long terminal repeat (RSV-LTR) Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pGal4-p65 |
| Further information: | The plasmid was derived from pGal4-p65 by site-directed mutagenesis. As a result, the serine codon at position 276 of the hNF-κB p65 subunit was replaced by a cysteine codon. Furthermore, an additional StuI site was created via a silent mutation of the arginin codon at position 274, replacing CGG by AGG. The plasmid contains the S. cerevisiae GALbd domain, composed of the first 147 codons from GAL4, fused to the mutated, full-length hNF-κB p65 coding sequence. The GALbd-p65S276C fusion protein can be used as a bait protein in two-hybrid screening. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727139.1. The nucleotide sequence of pGal4-p65 was compiled in accordance with the description in Schmitz et al. (1991). The fusion region between GALbd and the hNF-κB p65 subunit in pGal4-p65 was sequenced (F. Molemans, Dept of Biomedical Molecular Biology, Ghent University, Belgium). The nucleotide sequence of the hNF-κB p65 coding sequence corresponds with the EMBL Nucleotide Sequence Database accession number M62399.1. The nucleotide sequence of the 3' UTR of the hNF-κB p65 subunit was retrieved from the pRc/CMV-p65 sequence file provided by S. Plaisance (Dept of Biomedical Molecular Biology, Ghent University, Belgium). The nucleotide sequence upstream of GALbd in pGal4-p65 (from nucleotide position 3841 up to and including 4920) was analysed by BCCM/GeneCorner. Other names of the plasmid are pAB-p65S276C and pABgal4-p65 S276C. |
| EMBL Accession number: | M62399.1, view at EMBL, GenBank, DDBJ LT727139.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 30/09/2003 |
| Sequence detail: | Nucleotide sequence at the start of the S. cerevisiae GAL4 DNA-binding domain:
---------- GALbd ---------->
2
5' ... ACTG.ATG.GAC.TCC.CAG.CAG.CCA.GAT.CTG.AAG.CTA.CTG.TCT.TCT.ATC.GAA ... 3'
Met Asp Ser Gln Gln Pro Asp Leu Lys Leu Leu Ser Ser Ile Glu
*** BglII
Nucleotide sequence at the GALbd-p65S276C fusion:
-------------- GALbd -------------->
147 ---------------- linker
5' ... AAA.GGT.CAA.AGA.CAG.TTG.ACT.GTA.TCG.CCG.GAA.TTC.CCG.GGT.GTC
Lys Gly Gln Arg Gln Leu Thr Val Ser Pro Glu Phe Pro Gly Val
HindII EcoRI AvaI HindII
SmaI SalI
--------------- p65S276C --------->
linker ---------------> 1
GAC.CAG.GGG.ACC.CCG.GCC.ATG.GAC.GAA.CTG.TTC.CCC.CTC.ATC.TTC ... 3'
Asp Gln Gly Thr Pro Ala Met Asp Glu Leu Phe Pro Leu Ile Phe
***
NcoI
StyI
Mutator antisense primer used:
5' TGGGCTCACTGAGCTCCCGGTCGCAAGGCCTCCGCAGCTGCATGGAGACACGCAC 3'
Nucleotide sequence of the mutated region of the hNF-kB p65 subunit:
276
wt hNF-kBp65: 5' ... CAG.CTG.CGG.CGG.CCT.TCC.GAC.CGG.GAG.CTC ... 3'
Gln Leu Arg Arg Pro Ser Asp Arg Glu Leu
PvuII
S276C mutant: 5' ... CAG.CTG.CGG.AGG.CCT.TGC.GAC.CGG.GAG.CTC ... 3'
Gln Leu Arg Arg Pro Cys Asp Arg Glu Leu
^ ^
PvuII StuI
***: Start codon.
^ : Mutated nucleotide.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AvaI, BseRI, EcoRI, KpnI/SmaI, PvuI/XhoI, StuI and XhoI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr L. Vermeulen(1) and Prof. Dr G. Haegeman(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Vermeulen et al., EMBO J. 22 (2003), 1313-1324 [PMID: 12628924] |
| Related plasmid reference: | Zhong et al., Mol. Cell 1 (1998), 661-671 [PMID: 9660950] [DOI: 10.1016/s1097-2765(00)80066-0] Larsen et al., Diabetologia 48 (2005), 2582-2590 [PMID: 16283237] [DOI: 10.1007/s00125-005-0039-9] Schmitz et al., EMBO J. 10 (1991), 3805-3817 [PMID: 1935902] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 GM31 |
| Host reference: | Marinus, Mol. Gen. Genet. 127 (1973), 47-55 [PMID: 4589344] [DOI: 10.1007/BF00267782] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pGal4-p65S276C (LMBP 4644) is available at BCCM/GeneCorner. This plasmid was deposited by Dr L. Vermeulen and Prof. Dr G. Haegeman and was published in Vermeulen et al., 2003. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.