Last data update: 24 January 2024 16:39 CET
Plasmid name: pIRES-lacZ (LMBP 3460)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p3460.gb
(View with Genome Compiler) p3460.txt p3460.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Escherichia coli lac Z gene (lacZ); with modified 5' end and missing the EcoRI site at the 3' end |
| Promoter: | Phage T7 gene 10 promoter (T7g10) Phage T3 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
Internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV) polyprotein gene |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells |
| Parental clone: | pBluescriptIISK- |
| Further information: | The plasmid was constructed by ligating the lacZ coding sequence, preceded by an internal ribosome entry site, as an XhoI-BamHI fragment into the XhoI-BamHI opened pBluescriptIISK- vector. The IRES-lacZ insert allows to obtain bicistronic or polycistronic transcripts in mammalian cells, using the lacZ gene as a reporter gene. The nucleotide sequence of the IRES-lacZ insert was obtained from T. Van De Putte (LMB-CELGEN, KUL, Leuven, Belgium). As compared to the wild type sequence, lacZ shows some modifications at the N-terminus, where nucleotide positions 4 to 25 (ACCATGATTACGGATTCACTGG) are replaced with a shorter sequence (GAAGATC; positions 4 to 10). The EcoRI site at the 3' end of lacZ is removed. Since the nucleotide sequence at the 3' end of the IRES-lacZ insert, downstream from the lacZ coding sequence, could not be completely traced back, there is uncertainty as to the cutting frequency of the restriction enzymes, except for the sites that were analysed in the authenticity test. The nucleotide sequence of the 5' untranslated region of the EMCV polyprotein gene, containing the IRES sequence, corresponds with the EMBL Nucleotide Sequence Database accession number M81861.1. |
| EMBL Accession number: | M81861.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 08/03/1996 |
| Sequence detail: | Nucleotide sequence around the start of the lacZ gene:
---> lacZ 10
IRES --->| Met Glu Asp Pro Val
5' TTCCTTTGAAAAACACGATGATAA|GCTTGCCACAACC.ATG.GAA.GAT.CCC.GTC. 3'
HindIII *** --------- ^^^
NcoI
***: start codon.
-: modifications as compared to the wild type lacZ sequence.
^^^: codon corresponding to the 10th wild type lacZ codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AvaI/HindIII, BamHI/XhoI, EcoRI, HindII, NotI, PvuI and SspI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr D. Huylebroeck(1). (1) LMB-CELGEN, KUL, Leuven, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Bauman et al., Mol. Endocrinol. 20 (2006), 444-458 [PMID: 16179381] [DOI: 10.1210/me.2005-0287] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
| Related website: | http://www.iresite.org/IRESite_web.php?page=view&entry_id=140 |
Refer in your Materials and Methods: |
pIRES-lacZ (LMBP 3460) is available at BCCM/GeneCorner. This plasmid was deposited by Dr D. Huylebroeck. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.