Last data update: 24 January 2024 16:39 CET
Plasmid name: pIgK3conaLUC (LMBP 3249)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p3249.gb
(View with Genome Compiler) p3249.txt p3249.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC) |
| Promoter: | Chicken conalbumin (ovotransferrin) promoter (CONA) Mouse Igκ oligo enhancer (IgK3) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Mammalian cells |
| Parental clone: | pconaCAT; pUC-luc |
| Further information: | Reactivity of the conA promoter after TNF-stimulation of HEK293T cells was about 1000-fold higher as compared to pconaLuc (LMBP 3248) (personal communication of M. De Ceuleneer (GeneCorner)). When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727454.1. The nucleotide sequence file was recompiled according to the publications of Le Bail et al. (1993) and Kimura et al. (1986) mentioned in 'Related reference', and to information provided by Dr A. Israël. The vector contains the chicken conalbumin promoter (-102 to +62), preceded by 3 copies of a mouse Igκ oligo. The promoter region has been sequenced at the Department of Biomedical Molecular Biology (Ghent University, Belgium) and can be excised as a SalI/HindIII fragment. As the construction strategy is not completely known, there is uncertainty about the nucleotide sequence upstream of the anticlockwise orientated luciferase gene. The nucleotide sequence of the P. pyralis LUC cds and 3' UTR correspond with the EMBL Nucleotide Sequence Database accession number M15077.1. Name mentioned in Le Bail et al. (1993) is (Igκ)3-cona-luc construct. Name mentioned in Heyninck et al. (1999) is pNFconluc. |
| EMBL Accession number: | M15077.1, view at EMBL, GenBank, DDBJ LT727454.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 28/09/1999 |
| Sequence detail: | Sequence of the IgK insert:
5' GGATCTGGGGAATCCCCAGATCATGGGGAATCCCCAGATCATGGGGAATCCCCAGATCC 3'
----------- ----------- -----------
BamHI/BglII BglII/BamHI
---: IgK oligo |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI, EcoRV, EcoRV/PstI, HindIII, HindIII/SalI and KpnI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr A. Israël(1). (1) Institut Pasteur, Paris, France |
| Plasmid reference: | - |
| Related plasmid reference: | Staal et al., bioRxiv (2016), 1-42 [DOI: 10.1101/046789] Staal et al., bioRxiv (2017), 1-25 [DOI: 10.1101/228767] Staal et al., bioRxiv (2016), 1-42 [DOI: 10.1101/046789] Heyninck et al., FEBS Lett. 442 (1999), 147-150 [PMID: 9928991] Kimura et al., Cell 44 (1986), 261-272 [PMID: 3510743] Le Bail et al., EMBO J. 12 (1993), 5043-5049 [PMID: 8262046] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pIgK3conaLUC (LMBP 3249) is available at BCCM/GeneCorner. This plasmid was deposited by Dr A. Israël. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.