Last data update: 24 January 2024 16:39 CET
Plasmid name: pIgK3conalacZ (LMBP 4234)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4234.gb
(View with Genome Compiler) p4234.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Escherichia coli lac Z gene (lacZ) SV40 nuclear localization signal (NLS); N-terminal |
| Promoter: | Chicken conalbumin (ovotransferrin) promoter (CONA) Mouse Igκ oligo enhancer (IgK3) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli Mammalian cells |
| Parental clone: | pBluescriptIISK+; pSKT |
| Further information: | The vector contains the chicken conalbumin promoter (-102 to +62), preceded by 3 copies of a mouse Igκ oligo. The promoter region can be excised as a SalI/HindIII fragment. The nuclear localization sequence (NLS) is located at the start of the lacZ gene. The construct can be digested with XhoI and NotI to isolate the promoter-enhancer-NLS-lacZ fragment. This fragment can then be injected in mouse zygotes. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727332.1. The nucleotide sequence file was recompiled according to the publication of Schmidt-Ullrich and to information provided by Dr A. Israël. The promoter region, and the 5' and 3' UT regions of the Escherichia coli lac Z gene (lacZ) have been sequenced at the Department of Biomedical Molecular Biology (Ghent University, Belgium). Name mentioned in Schmidt-Ullrich et al. (1996) is (Igκ)3conalacZ. Other name of the plasmid is placZ. |
| EMBL Accession number: | LT727332.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 15/12/2003 |
| Sequence detail: | Sequence of the IgK insert:
5' tctggggattccccatgatctggggattccccatgatctggggattccccaga 3'
----------- ----------- -----------
---: IgK oligo |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI, EcoRI, EcoRV, HindIII, HindIII/SalI, NotI/XhoI and SalI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr A. Israël(1). (1) Institut Pasteur, Paris, France |
| Plasmid reference: | Schmidt-Ullrich et al., Development 122 (1996), 2117-2128 [PMID: 8681793] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pIgK3conalacZ (LMBP 4234) is available at BCCM/GeneCorner. This plasmid was deposited by Dr A. Israël and was published in Schmidt-Ullrich et al., 1996. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.