Last data update: 24 January 2024 16:39 CET
Plasmid name: pLF10T5 (LMBP 3387)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | plf10t5.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | Phage λ major leftward promoter (λ PL) Phage T7 gene 10 promoter (T7g10) Phage T3 promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
| Terminator: | Phage fd terminator Phage T7 gene 10 terminator (T7g10) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | pLT10g10T; pLT10T3 |
| Further information: | The construction of this phasmid is described in figure 2 of Mertens et al., Gene 164 (1995), 9-15. However, the parental clone was not pLF10T but pLT10g10T in which the H6EK linker was fused to the filled-in (Klenow DNA polymerase) AccI site (after the 121st codon) of the T7g10 gene (Nico Mertens: personal communication). This is a useful phasmid for heterologous gene expression in Escherichia coli under control of the strong and efficiently regulatable λ PL or the T7 gene 10 promoter. Transcriptional read-through from these promoters is minimized by the presence of a duplicated T7 transcription terminator and a duplicated fd transcription terminator. Read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin. pLF10T5 also contains a linker (H6EK) composed of a hexameric histidine-encoding fragment (allowing the synthesis of affinity-tagged fusion proteins) followed by the enterokinase recognition site (allowing the precise release of the mature heterologous gene). This H6EK linker is fused behind the 121st codon of T7g10. The phasmid is designed for insertion of the gene of interest between the BbeI site (or one of his neoschizomers) and a site at choice in the extended multicloning site downstream from the PL and T7 promoters. Desired coding sequences may be fused in frame to the enterokinase site by joining to either the BbeI, NarI or KasI cut sequence. Furthermore, the phasmid is provided with an antisense phage T3 promoter. It also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7. For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid. |
| EMBL Accession number: | - |
| Latest sequence update: | 13/05/1996 |
| Sequence detail: | Nucleotide sequence following the Shine-Dalgarno (SD) position of the T7 gene 10 ribosome binding site:
|
5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
---------------->| XbaI
T7 promoter
---> T7g10 T7g10 --->|
1 121
TAAGAAGGAGATATACAT ATG.GCT.AGC.ATG.ACT. ... .TCT.GAG.TAT|
------ NdeI -----|
SD Filled-in
AccI site
linker
--------------------------------------------------------
GAT.CCA.CAT.CAC.CAT.CAC.CAT.CAC.GAC.GAT.GAC.GAT.AAG^GCG.
Asp Pro His His His His His His Asp Asp Asp Asp Lys
----------------------- -------------------
*1 *2 NarI
KasI/ApaI fusion
-|- @
C|CG.ACG.TCG.CAT.GCT.CCT.CTA.GAC.TCG.AGG.AAT.TCG.GTA.CCC.
AatII SphI XbaI XhoI EcoRI KpnI SmaI
AvaI AvaI
@ @
CGG.GTT.CGA.AAT.CGA.TAA.GCT.TAT.GCA.TGC.GGC.CGC.ATC.TAG.
AsuII ClaI HindIII AvaIII NotI XbaI
SphI
AGG.GCC.CGG.ATC.CCT.CGA.GGT.CGA.CGA.ATT.CGA.GCT.CGG.CCG.ACT.
ApaI BamHI XhoI AccI EcoRI SacI SfiI
AvaI SalI
T3 promoter
|<-----------------------
TGG.CCT.TCC.C|TT.TAG.TGA.GGG.TTA.ATA.A 3'
@ @ @ @
@: Termination codon.
SD: Shine-Dalgarno.
*1: Metal chelating affinity tail.
*2: Enterokinase site.
^: Cleavage site of the enterokinase.
Punctuation indicates reading frame. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr N. Mertens(1) (2) and Prof. Dr E. Remaut(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061(λ) |
| Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pLF10T5 (LMBP 3387) is available at BCCM/GeneCorner. This plasmid was deposited by Dr N. Mertens and Prof. Dr E. Remaut and was published in Mertens et al., 1995. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.