Last data update: 24 January 2024 16:39 CET
Plasmid name: pLT10T (LMBP 3281)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p3281.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | Phage λ major leftward promoter (λ PL) Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
| Terminator: | Phage T7 gene 10 terminator (T7g10) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | - |
| Further information: | pLT10T was designed for bacterial expression of heterologous genes after an ApaI digestion and blunting the 3' sticky ends with T4 DNA polymerase, making the ATG start codon on the plasmid accessible for blunt-end ligation to fragments encoding the mature coding sequence. For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid. Other name of the plasmid is pPLT10T. |
| EMBL Accession number: | - |
| Latest sequence update: | 30/03/1995 |
| Sequence detail: | Nucleotide sequence around the Shine-Dalgarno (SD) position of the T7 gene 10 ribosome binding site:
-- T7 promoter ->
5'... TAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
XbaI
TAAGAAGGAGATATACAT.ATG.GGC.CCG.ACG.TCG.CAT.GCT.CCT.CTA.GAC.TCG
--SD-- *** AatII SphI XbaI XhoI
NdeI ApaI
AGG.AAT.TCG.GTA.CCC.CGG.GTT.CGA.AAT.CGA.TAA. ...3'
EcoRI KpnI SmaI AsuII ClaI +++
HindIII
***: start codon.
+++: termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: ApaI, EcoRI, HincII and RsaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr N. Mertens(1) (2) and Prof. Dr E. Remaut(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061(λ) |
| Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pLT10T (LMBP 3281) is available at BCCM/GeneCorner. This plasmid was deposited by Dr N. Mertens and Prof. Dr E. Remaut and was published in Mertens et al., 1995. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.