Last data update: 24 January 2024 16:39 CET
Plasmid name: pLTp35 (LMBP 3918)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: | p3918.gb (View with Genome Compiler) |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Baculovirus protein p35 cDNA |
| Promoter: | Phage λ major leftward promoter (λ PL) Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
| Terminator: | Phage fd terminator Phage T7 gene 10 terminator (T7g10) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | pLT10hIL2TH |
| Further information: | This phasmid was constructed as follows: a PCR product containing the complete coding sequence of baculovirus p35 cDNA was inserted as (filled-in) EcoRI/BamHI fragment into the EheI site downstream from the H6EK tag of pLT10hIL2TH. The H6EK linker is composed of a hexameric histidine-encoding fragment (allowing the synthesis of affinity-tagged fusion proteins) followed by the enterokinase recognition site (allowing the precise release of the mature heterologous gene). This H6EK linker directly follows the ATG start codon. Mature human IL2 CDS (except its first codon) is still present, due to the construction strategy. The phasmid can be used to make in vitro translated baculovirus p35. Transcriptional read-through from the promoters is minimized by the presence of a duplicated T7 transcription terminator and a duplicated fd transcription terminator. Read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin. Furthermore, the phasmid is provided with an antisense phage T3 promoter. It also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7. For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727287.1. Other name of the plasmid is pLT10T3HISp35. |
| EMBL Accession number: | LT727287.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 01/07/1999 |
| Sequence detail: | Nucleotide sequence following the Shine-Dalgarno (SD) position of the T7 gene 10 ribosome binding site:
|
5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
---------------->| XbaI
T7 promoter
linker
---------------------------------------
TAAGAAGGAGATATACAT ATG.GAT.CCA.CAT.CAC.CAT.CAC.CAT.CAC.GAC.GAT.
------ NdeI Asp Pro His His His His His His Asp Asp
SD BamHI ----------------------- -------
*1 *2a
EheI/BamHI fusion
| | -->signal sequence of p35
--------------|-- |
GAC.GAT.AAG^GC|G.ATC.CCT.ATG.TGT.GTA.ATT.TTT.CCG.GTA...3'
Asp Asp Lys
-----------
*2b
SD: Shine-Dalgarno.
*1: Metal chelating affinity tail.
*2a: First part of the enterokinase site.
*2b: Completing part of the enterokinase site.
^: Cleavage site of the enterokinase.
Punctuation indicates reading frame.
Used PCR primers:
Forward primer
5' GCGGATCCCTATGTGTGTAATTTTTCCGGTAGA 3'
BamHI
Reverse primer
5' GCGGAATTCGCAATGACAAAATAATATTAGGC 3'
EcoRI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI, EcoRI and SpeI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by P. Schotte(1) (2) and Prof. Dr R. Beyaert (1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061(λ) |
| Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pLTp35 (LMBP 3918) is available at BCCM/GeneCorner. This plasmid was deposited by P. Schotte and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.