Last data update: 24 January 2024 16:39 CET
Plasmid name: pMB-7 (LMBP 4216)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4216.gb
(View with Genome Compiler) p4216.txt p4216.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Salmonella enterica serovar Typhimurium ATP phosphoribosyltransferase gene (hisG); modified Candida albicans uracil 3 gene (URA3) |
| Promoter: | Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) Candida albicans URA3; auxotrophic |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Candida albicans; ura3(-), integrative |
| Parental clone: | pUC18; pCUB-6 |
| Further information: | The plasmid was constructed as follows: 1) a BglII site was inserted by addition of a linker at the SmaI site of pUC18; 2) the hisG-URA3-hisG BamHI/BglII fragment from pCUB-6 was inserted between the BamHI and BglII sites of the modified pUC18, resulting in p5921; 3) the recognition site for the Saccharomyces cerevisiae I-SceI endonuclease was inserted in each of the two StyI sites of p5921 by using a 28-mer. The orientation of the linker at position 657 is unknown. The hisG-URA3-hisG disruption cassette consists of the C. albicans URA3 gene, flanked at its 5' and 3' end by the S. typhimurium hisG gene carrying the I-SceI recognition site. The I-SceI recognition site is statistically not expected to be present within the C. albicans genome. Consequently, digestion with I-SceI cleaves the chromosomes only at the location of the disrupted genes and the length of the resulting fragments indicates their chromosomal location. LMBP will analyse the CaURA3 sequence to verify whether it corresponds with the EMBL Nucleotide Sequence Database accession number X14198 (version SV 1) or with the EMBL Nucleotide Sequence Database accession number AF109400 (version SV 1). The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727326.1. The nucleotide sequence of the Salmonella hisG coding sequence corresponds with the EMBL Nucleotide Sequence Database accession number J01804.1. The region between the Candida URA3 gene and the second Salmonella hisG coding sequence was sequenced by LMBP. Other name of the plasmid is pMB7. |
| EMBL Accession number: | J01804.1, view at EMBL, GenBank, DDBJ LT727326.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 30/10/2009 |
| Sequence detail: | Salmonella hisG with Saccharomyces cerevisiae I-SceI endonuclease recognition sequence:
> hisG codons 1->278 >----------- 28-mer -----------
5' ATGTTAGAC...TGGGAAACCATGGATCCTAGGG ATAA|CAGGGTAATAGATCCATGGAGAAACTGA 3'
3' ATCCC|TATT GTCCCATTA 5'
StyI -------------------- StyI
BamHI I-SceI
StyI
|: cut site. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglII, BstZI/PvuI, DraI, EcoRI, HindII and RsaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr W.A. Fonzi(1). (1) Department of Microbiology and Immunology, Georgetown University, Washington, USA |
| Plasmid reference: | Fonzi et al., Genetics 134 (1993), 717-728 [PMID: 8349105] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pMB-7 (LMBP 4216) is available at BCCM/GeneCorner. This plasmid was deposited by Dr W.A. Fonzi and was published in Fonzi et al., 1993. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.