Last data update: 24 January 2024 16:39 CET
Plasmid name: pNIL2 (LMBP 3075)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p3075.gb
(View with Genome Compiler) p3075.txt |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Escherichia coli outer membrane protein A cDNA (ompA, tolG, GeneID 945571); signal sequence Mouse interleukin 2 cDNA (IL2); mature sequence |
| Promoter: | Escherichia coli hybrid tryptophan/lacUV5 promoter (tac) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) Ribosome binding site (RBS) of the Escherichia coli outer membrane protein II gene (ompA) |
| Terminator: | Phage fd terminator |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pSIL2 |
| Further information: | pNIL2 is an expression vector containing the ompA signal sequence fused to the mouse IL2 mature sequence downstream from the IPTG-inducible tac promoter. As compared to pSIL2, mouse IL2 is secreted very poorly upon induction. pNIL2 provides resistance to ampicillin, but is sensitive to chloramphenicol in sup(-) strains. pNIL2 contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7. The presence of the lacI(q) repressor gene is necessary to control the activity of the tac promoter. After mutagenesis, use mutS strains for primary transformation (e.g. sup(-) strain WK6mutS, sup(+) strain BMH71-18mutS); for segregation of possible mutants: sup(-) strains (e.g. WK6). This plasmid was derived from pSIL2 via site-specific mutagenesis. Consequently, the serine-encoding TCA-triplet between the Escherichia coli ompA signal sequence and the mature mouse IL2 cDNA was removed . The mutation was confirmed by DNA sequence analysis. Other names of the plasmid are pMa519KSompAmIL2Ser(-) and pOmIL2N. |
| EMBL Accession number: | X01772, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 29/05/1997 |
| Sequence detail: | Primer used for site-specific mutagenesis:
5' GGAGCTTGAAGTGGGTGCGGCCTGCGCTACGG 3'
Nucleotide sequence at the ompA-mIL2 fusion:
--- ompA signal sequence --> ----------- mIL2 ---------->
pNIL2: 5' ... TTC.GCT.ACC.GTA.GCG.CAG.GCC.GCA.CCC.ACT.TCA.AGC.TCC.ACT ... 3'
Phe Ala Thr Val Ala Gln Ala Ala Pro Thr Ser Ser Ser Thr
HaeIII
filled in DdeI-FspI fusion
--- ompA signal sequence --> ----------- mIL2 ---------->
pSIL2: 5' ... TTC.GCT.ACC.GTA.GCG.CAG.GCC.TCA.GCA.CCC.ACT.TCA.AGC.TCC.ACT ... 3'
Phe Ala Thr Val Ala Gln Ala Ser Ala Pro Thr Ser Ser Ser Thr
StuI DdeI
HaeIII
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI, HindII, PvuII/XmnI, ScaI and StuI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr E. Remaut(1) (2). It was constructed by J. Robbens(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | PhD thesis Johan Robbens (1994) |
| Related plasmid reference: | Stanssens et al., Nucleic Acids Res. 17 (1989), 4441-4454 [PMID: 2501754] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 RR1ZΔM15 |
| Host reference: | Altieri et al., J. Bacteriol. 168 (1986), 648-654 [PMID: 2946661] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) + chloramphenicol (25 μg/ml)* |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Cultivation remark: | *: selection of transformants on chloramphenicol; subsequent cultivation of a single colony in liquid medium with ampicillin. E. coli RR1ΔM15 is characterized by a suppressor mutation (supE44). As such, this host/plasmid combination also provides resistance to chloramphenicol (mutated chloramphenicol resistance gene present on the plasmid). |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pNIL2 (LMBP 3075) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut and was published in Johan Robbens, 1994. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.