Last data update: 24 January 2024 16:39 CET
Plasmid name: pPLT10mIFNBmT (LMBP 3659)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p3659.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse interferon β cDNA (IFNB); mutated mature sequence |
| Promoter: | Phage λ major leftward promoter (λ PL) Phage T7 gene 10 promoter (T7g10) Phage T3 promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
| Terminator: | Phage fd terminator Phage T7 gene 10 terminator (T7g10) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | pLT10T3; pMacT10mIFNBm |
| Further information: | The plasmid was constructed by inserting the NdeI/HindIII fragment of pMacT10mIFNBm, containing the mature, mouse interferon β (IFNB) gene, between the NdeI and HindIII sites of the pLT10T3 vector. pPLT10mIFNBmT is an expression phasmid for mutated mouse IFNB in Escherichia coli under control of the strong and efficiently regulatable λ PL or T7 gene 10 promoter. The mutations in the mature mouse IFNB gene should lead to the formation of intra-chain disulfide bonds in the expressed protein, resulting in a more stable product. For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid. Other name of the plasmid is pPLT10mIFNBm. |
| EMBL Accession number: | - |
| Latest sequence update: | 04/05/1999 |
| Sequence detail: | Nucleotide sequence around the Shine-Dalgarno (SD) position of the T7 gene 10 ribosome binding site:
|
5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
---------------->| XbaI
T7 promoter
1 2 3 4 5 6
TAAGAAGGAGATATACAT ATG.ATC.ACC.TAT.AAG.CAG.CTC … 3'
------ NdeI |--> mature IFNB
SD
Nucleotide sequence around the codon at amino acid position 17 of the mature mIFNB gene:
14 15 16 17 18 19 20
Ile Arg Lys Cys Gln Glu Leu
wt mIFNB: 5' ... .ATT.CGG.AAA.TGT.CAG.GAG.CTC. ... 3'
SacI
14 15 16 17 18 19 20
Ile Arg Lys Ser Gln Glu Leu
mutated mIFNB: 5' ... .ATT.CGG.AAA.TCC.CAG.GAG.CTC. ... 3'
** SacI
BsaJI
Nucleotide sequence around the codon at amino acid position 29 of the mature mIFNB gene:
26 27 28 29 30 31 32
Gly Lys Ile Asn Leu Thr Tyr
wt mIFNB: 5' ... .GGA.AAG.ATC.AAC.CTC.ACC.TAC. ... 3'
26 27 28 29 30 31 32
Gly Lys Ile Cys Leu Thr Tyr
mutated mIFNB: 5' ... .GGA.AAG.ATC.TGC.CTC.ACC.TAC. ... 3'
BglII **
Nucleotide sequence around the codons at amino acid positions 136 and 137 of the mature mIFNB gene:
133 134 135 136 137 138 139
Tyr Asn Ser Tyr Ala Trp Met
wt mIFNB: 5' ... .TAC.AAC.AGC.TAC.GCC.TGG.ATG. ... 3'
BstNI
Tyr Asn Ser Cys Ala Trp Met
mutated mIFNB: 5' ... .TAC.AAC.AGC.TGC.GCA.TGG.ATG. ... 3'
PvuII * *
FspI
SD: Shine-Dalgarno.
*: Mutated nucleotide
Punctuation indicates reading frame. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr E. Remaut(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061[pICA2] |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Helper plasmid: | pICA2 |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) + kanamycin (50 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pPLT10mIFNBmT (LMBP 3659) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.