Last data update: 24 January 2024 16:39 CET
Plasmid name: pPLc2819FdT1 (LMBP 741)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p741.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
- |
Promoter: | Phage λ major leftward promoter (λ PL) |
Ribosome binding site: |
- |
Terminator: | Phage fd terminator |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
Parental clone: | pPLc2819 |
Further information: | The plasmid contains fd terminator (fdT) and the lac operator fragment (lacO) flanked by several unique restriction sites, and the in a functional orientation relative to the λ-PL promoter. The orientation of the 'fdT-lacO' fragment was experimentally verified. The lac operator fragment is suitable as a screeningsmarker on lacZ indicator plates in lac positive strains. The HindIII, PstI and XbaI expression sites are not unique. |
EMBL Accession number: | - |
Latest sequence update: | 03/04/1989 |
Sequence detail: | Nucleotide sequence downstream from the PL promoter: 5' GAATTCCGGATCCGGCCAAGCTTGGCTCTAGAGGCTGCAGCCTCTAGAGGGTCGAAATT 3' EcoRI BamHI HindIII XbaI PstI XbaI BspMII |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr E. Remaut(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli W6 (λrex) |
Host reference: | - |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 28°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pPLc2819FdT1 (LMBP 741) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.